Incidental Mutation 'R8747:Mroh2b'
ID 663624
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R8747 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4935300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 926 (S926T)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: S926T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: S926T

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,240 D190G probably benign Het
8430408G22Rik T A 6: 116,652,161 L155Q possibly damaging Het
Abhd11 A G 5: 135,011,906 I271V possibly damaging Het
AI314180 C T 4: 58,828,632 V934I probably damaging Het
Akap6 T G 12: 53,142,216 S2138A probably benign Het
Amn C A 12: 111,275,006 P235H probably damaging Het
Arf2 A T 11: 103,969,149 M18L probably benign Het
Asic2 A T 11: 81,152,407 F20Y possibly damaging Het
Bok T C 1: 93,694,942 probably null Het
Cachd1 T A 4: 101,002,848 probably benign Het
Casp8 A G 1: 58,844,458 N308S probably benign Het
Cavin3 G T 7: 105,481,947 H71Q possibly damaging Het
Ccdc87 A G 19: 4,841,618 I713V probably benign Het
Clcn6 A T 4: 148,008,897 probably null Het
Cmas T C 6: 142,771,201 I273T possibly damaging Het
Ctxn3 A T 18: 57,477,306 D65V probably damaging Het
D130040H23Rik C A 8: 69,303,053 N387K probably benign Het
Dnah9 T C 11: 65,927,990 K3174R possibly damaging Het
Efcab14 A G 4: 115,746,596 N157S probably damaging Het
Ets1 G A 9: 32,730,178 G109D probably damaging Het
Fbln5 G A 12: 101,768,495 R173C probably damaging Het
Fchsd1 G A 18: 37,962,982 P525L probably benign Het
Gmppa G A 1: 75,439,381 V156I probably damaging Het
Gtpbp1 A G 15: 79,719,281 D182G Het
Ift140 T A 17: 25,035,835 S430T probably benign Het
Kat7 G C 11: 95,294,566 C161W probably damaging Het
Lipk T A 19: 34,018,784 M32K probably damaging Het
Lum A T 10: 97,568,489 D82V possibly damaging Het
Macf1 C A 4: 123,355,151 A7196S probably damaging Het
Nbn G T 4: 15,981,555 R549I probably damaging Het
Nfu1 T C 6: 87,019,418 I117T probably damaging Het
Olfr1355 A G 10: 78,879,321 T50A probably benign Het
Olfr566 T C 7: 102,856,932 T117A probably benign Het
Parp1 T C 1: 180,594,710 L778P probably damaging Het
Pbld2 G T 10: 63,052,290 V125F probably benign Het
Prkag2 A G 5: 24,880,682 probably null Het
Prss54 A G 8: 95,559,723 F241L probably benign Het
Rnf121 T C 7: 102,029,109 D177G probably damaging Het
Slc12a7 G A 13: 73,785,122 V100I probably benign Het
Slc28a1 C T 7: 81,124,971 L189F possibly damaging Het
Slc35a3 T C 3: 116,694,570 Q16R probably damaging Het
Snap91 A G 9: 86,804,524 F354L probably damaging Het
Steap2 A G 5: 5,673,539 I447T probably benign Het
Tagap T A 17: 7,928,770 I104N probably damaging Het
Tas1r2 A G 4: 139,660,007 D259G probably benign Het
Tgm3 T C 2: 130,044,532 S558P probably benign Het
Tuba3a A G 6: 125,281,055 V324A probably damaging Het
Vmn1r238 T G 18: 3,123,232 I61L possibly damaging Het
Vmn1r52 A G 6: 90,179,469 T252A probably benign Het
Vmp1 A G 11: 86,602,059 V308A probably damaging Het
Wdfy4 A C 14: 33,152,654 V159G Het
Zfp180 A G 7: 24,105,262 T369A possibly damaging Het
Zfp827 A G 8: 79,028,687 M1V probably null Het
Zmym4 A G 4: 126,893,405 I1031T probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8910:Mroh2b UTSW 15 4931373 missense probably benign 0.01
R8913:Mroh2b UTSW 15 4917528 intron probably benign
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4951184 missense probably benign
R9429:Mroh2b UTSW 15 4934425 missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGCAAAGCCAAGGGTG -3'
(R):5'- GTCGTGTACACCTTTAGTCTTAGC -3'

Sequencing Primer
(F):5'- GTGGTGTCTCCCAACTCCAAAG -3'
(R):5'- ACACCTTTAGTCTTAGCTCTTGGGAG -3'
Posted On 2021-03-08