Incidental Mutation 'R8747:Vmn1r238'
ID 663628
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Name vomeronasal 1 receptor, 238
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8747 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 3122492-3123412 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3123232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 61 (I61L)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
AlphaFold E9Q373
Predicted Effect possibly damaging
Transcript: ENSMUST00000165255
AA Change: I61L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: I61L

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,240 D190G probably benign Het
8430408G22Rik T A 6: 116,652,161 L155Q possibly damaging Het
Abhd11 A G 5: 135,011,906 I271V possibly damaging Het
AI314180 C T 4: 58,828,632 V934I probably damaging Het
Akap6 T G 12: 53,142,216 S2138A probably benign Het
Amn C A 12: 111,275,006 P235H probably damaging Het
Arf2 A T 11: 103,969,149 M18L probably benign Het
Asic2 A T 11: 81,152,407 F20Y possibly damaging Het
Bok T C 1: 93,694,942 probably null Het
Cachd1 T A 4: 101,002,848 probably benign Het
Casp8 A G 1: 58,844,458 N308S probably benign Het
Cavin3 G T 7: 105,481,947 H71Q possibly damaging Het
Ccdc87 A G 19: 4,841,618 I713V probably benign Het
Clcn6 A T 4: 148,008,897 probably null Het
Cmas T C 6: 142,771,201 I273T possibly damaging Het
Ctxn3 A T 18: 57,477,306 D65V probably damaging Het
D130040H23Rik C A 8: 69,303,053 N387K probably benign Het
Dnah9 T C 11: 65,927,990 K3174R possibly damaging Het
Efcab14 A G 4: 115,746,596 N157S probably damaging Het
Ets1 G A 9: 32,730,178 G109D probably damaging Het
Fbln5 G A 12: 101,768,495 R173C probably damaging Het
Fchsd1 G A 18: 37,962,982 P525L probably benign Het
Gmppa G A 1: 75,439,381 V156I probably damaging Het
Gtpbp1 A G 15: 79,719,281 D182G Het
Ift140 T A 17: 25,035,835 S430T probably benign Het
Kat7 G C 11: 95,294,566 C161W probably damaging Het
Lipk T A 19: 34,018,784 M32K probably damaging Het
Lum A T 10: 97,568,489 D82V possibly damaging Het
Macf1 C A 4: 123,355,151 A7196S probably damaging Het
Mroh2b T A 15: 4,935,300 S926T probably damaging Het
Nbn G T 4: 15,981,555 R549I probably damaging Het
Nfu1 T C 6: 87,019,418 I117T probably damaging Het
Olfr1355 A G 10: 78,879,321 T50A probably benign Het
Olfr566 T C 7: 102,856,932 T117A probably benign Het
Parp1 T C 1: 180,594,710 L778P probably damaging Het
Pbld2 G T 10: 63,052,290 V125F probably benign Het
Prkag2 A G 5: 24,880,682 probably null Het
Prss54 A G 8: 95,559,723 F241L probably benign Het
Rnf121 T C 7: 102,029,109 D177G probably damaging Het
Slc12a7 G A 13: 73,785,122 V100I probably benign Het
Slc28a1 C T 7: 81,124,971 L189F possibly damaging Het
Slc35a3 T C 3: 116,694,570 Q16R probably damaging Het
Snap91 A G 9: 86,804,524 F354L probably damaging Het
Steap2 A G 5: 5,673,539 I447T probably benign Het
Tagap T A 17: 7,928,770 I104N probably damaging Het
Tas1r2 A G 4: 139,660,007 D259G probably benign Het
Tgm3 T C 2: 130,044,532 S558P probably benign Het
Tuba3a A G 6: 125,281,055 V324A probably damaging Het
Vmn1r52 A G 6: 90,179,469 T252A probably benign Het
Vmp1 A G 11: 86,602,059 V308A probably damaging Het
Wdfy4 A C 14: 33,152,654 V159G Het
Zfp180 A G 7: 24,105,262 T369A possibly damaging Het
Zfp827 A G 8: 79,028,687 M1V probably null Het
Zmym4 A G 4: 126,893,405 I1031T probably damaging Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3122529 missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3123365 nonsense probably null
R8930:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R8932:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R9279:Vmn1r238 UTSW 18 3122994 missense probably damaging 0.99
R9382:Vmn1r238 UTSW 18 3122676 missense probably damaging 0.99
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACCTGGAGTTATTGGGG -3'
(R):5'- TCAAGTTCAGGGATTTTGGACC -3'

Sequencing Primer
(F):5'- GCTGATGGTGATTGCTTGGAAAC -3'
(R):5'- TTAATAGGAATGAAAATGGATCCTGG -3'
Posted On 2021-03-08