Incidental Mutation 'R8748:Ildr1'
ID 663672
Institutional Source Beutler Lab
Gene Symbol Ildr1
Ensembl Gene ENSMUSG00000022900
Gene Name immunoglobulin-like domain containing receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8748 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36693978-36726804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 36722372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 422 (E422A)
Ref Sequence ENSEMBL: ENSMUSP00000023617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]
AlphaFold Q8CBR1
Predicted Effect probably benign
Transcript: ENSMUST00000023617
AA Change: E422A

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: E422A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 213 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089618
AA Change: E378A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: E378A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 2.8e-27 PFAM
low complexity region 380 428 N/A INTRINSIC
low complexity region 437 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119464
AA Change: E422A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: E422A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A C 9: 35,909,055 D25A probably damaging Het
Abca8b A T 11: 109,945,771 F1233I probably damaging Het
Adgrl2 A G 3: 148,826,390 I87T Het
Atr A G 9: 95,932,423 M2058V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bscl2 A G 19: 8,847,947 E365G probably damaging Het
Casd1 T A 6: 4,608,634 S77R probably benign Het
Ccdc91 T C 6: 147,562,696 I214T unknown Het
Chpf2 T C 5: 24,591,823 F589S probably damaging Het
Cmya5 T A 13: 93,089,721 Y2953F probably damaging Het
Cts8 A T 13: 61,249,272 V278D probably damaging Het
Cyp20a1 T C 1: 60,353,022 V79A probably damaging Het
Dach1 G A 14: 97,828,334 Q686* probably null Het
Daxx A G 17: 33,912,164 D355G probably damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Eif4ebp2 A T 10: 61,435,027 H74Q probably benign Het
Exoc3l T C 8: 105,290,145 D679G probably damaging Het
Fam126a T A 5: 23,965,322 D343V probably benign Het
Fam13c T A 10: 70,542,686 W349R probably damaging Het
Fat3 A T 9: 15,922,865 Y4144N possibly damaging Het
Gm3376 T A Y: 3,774,915 probably null Het
Gm37240 A G 3: 84,497,738 *253Q probably null Het
Gm498 T C 7: 143,891,819 I201T probably benign Het
Itsn2 A G 12: 4,701,337 E1309G probably benign Het
Macf1 T C 4: 123,474,275 D2231G probably benign Het
Mtnr1a T C 8: 45,085,638 S38P probably benign Het
Olfr1417 A G 19: 11,828,232 S265P probably damaging Het
Olfr745 G T 14: 50,642,754 V152F probably benign Het
Olfr958 C G 9: 39,550,415 G152A possibly damaging Het
Olfr958 C A 9: 39,550,416 G152* probably null Het
Pcdhb9 G A 18: 37,402,848 G632S probably damaging Het
Pgr C A 9: 8,958,448 L819I probably benign Het
Phrf1 T C 7: 141,258,235 S448P unknown Het
Pip5k1a A G 3: 95,064,384 M471T probably benign Het
Postn A G 3: 54,389,339 D758G probably damaging Het
Rpl3 T C 15: 80,079,701 I280V probably benign Het
Rtl1 A T 12: 109,595,058 S116T probably benign Het
Six5 A G 7: 19,095,124 H163R probably benign Het
Smarca4 A G 9: 21,634,868 D114G possibly damaging Het
Tex46 C T 4: 136,610,497 probably benign Het
Tmem144 A G 3: 79,836,232 probably null Het
Unc5d T C 8: 28,696,425 T617A probably benign Het
Vmn1r74 T A 7: 11,846,976 S68T probably benign Het
Zfp184 G A 13: 21,960,047 R641Q probably benign Het
Zfp583 C T 7: 6,316,420 R531H probably benign Het
Zfp764 T C 7: 127,404,690 E423G possibly damaging Het
Other mutations in Ildr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Ildr1 APN 16 36722350 missense probably damaging 1.00
IGL02505:Ildr1 APN 16 36716164 missense probably damaging 1.00
R0295:Ildr1 UTSW 16 36709477 critical splice acceptor site probably null
R1649:Ildr1 UTSW 16 36708319 missense probably damaging 1.00
R1728:Ildr1 UTSW 16 36708336 missense possibly damaging 0.80
R1990:Ildr1 UTSW 16 36716206 missense probably damaging 0.99
R2020:Ildr1 UTSW 16 36725541 missense probably damaging 0.97
R2110:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R2111:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R4755:Ildr1 UTSW 16 36722021 missense probably benign 0.00
R4798:Ildr1 UTSW 16 36722555 missense possibly damaging 0.66
R4973:Ildr1 UTSW 16 36708298 missense probably benign 0.10
R5014:Ildr1 UTSW 16 36721559 missense probably damaging 0.98
R5426:Ildr1 UTSW 16 36709619 missense probably damaging 1.00
R5957:Ildr1 UTSW 16 36725534 makesense probably null
R7058:Ildr1 UTSW 16 36722368 missense probably benign 0.01
R7646:Ildr1 UTSW 16 36721919 missense possibly damaging 0.78
R8245:Ildr1 UTSW 16 36709521 missense probably damaging 1.00
R8392:Ildr1 UTSW 16 36722358 nonsense probably null
R8392:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R8791:Ildr1 UTSW 16 36708400 missense probably damaging 0.96
R8854:Ildr1 UTSW 16 36715548 missense probably damaging 1.00
R9108:Ildr1 UTSW 16 36715557 missense probably benign 0.13
R9252:Ildr1 UTSW 16 36716212 missense probably damaging 1.00
R9372:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R9434:Ildr1 UTSW 16 36709500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCGATCTGAGTGAGC -3'
(R):5'- AGGCCAGTTTGGAGACTGTG -3'

Sequencing Primer
(F):5'- ATCTGAGTGAGCGCCCGAG -3'
(R):5'- TGGAGACTGTGAGCGGC -3'
Posted On 2021-03-08