Mutagenetix > Incidental Mutation

Incidental Mutation 'R8748:Ildr1'

663672

Institutional Source

Beutler Lab

Gene Symbol

Ildr1

Ensembl Gene

ENSMUSG00000022900

Gene Name

immunoglobulin-like domain containing receptor 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8748 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36693978-36726804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 36722372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 422 (E422A)

Ref Sequence

ENSEMBL: ENSMUSP00000023617 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]

AlphaFold

Q8CBR1

Predicted Effect

probably benign
Transcript: ENSMUST00000023617
AA Change: E422A

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: E422A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	213	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089618
AA Change: E378A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: E378A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	2.8e-27	PFAM
low complexity region	380	428	N/A	INTRINSIC
low complexity region	437	445	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119464
AA Change: E422A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: E422A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 97.9%

Validation Efficiency

96% (43/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	A	C	9: 35,909,055	D25A	probably damaging	Het
Abca8b	A	T	11: 109,945,771	F1233I	probably damaging	Het
Adgrl2	A	G	3: 148,826,390	I87T		Het
Atr	A	G	9: 95,932,423	M2058V	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Bscl2	A	G	19: 8,847,947	E365G	probably damaging	Het
Casd1	T	A	6: 4,608,634	S77R	probably benign	Het
Ccdc91	T	C	6: 147,562,696	I214T	unknown	Het
Chpf2	T	C	5: 24,591,823	F589S	probably damaging	Het
Cmya5	T	A	13: 93,089,721	Y2953F	probably damaging	Het
Cts8	A	T	13: 61,249,272	V278D	probably damaging	Het
Cyp20a1	T	C	1: 60,353,022	V79A	probably damaging	Het
Dach1	G	A	14: 97,828,334	Q686*	probably null	Het
Daxx	A	G	17: 33,912,164	D355G	probably damaging	Het
Dmrt3	G	A	19: 25,611,186	A130T	probably benign	Het
Eif4ebp2	A	T	10: 61,435,027	H74Q	probably benign	Het
Exoc3l	T	C	8: 105,290,145	D679G	probably damaging	Het
Fam126a	T	A	5: 23,965,322	D343V	probably benign	Het
Fam13c	T	A	10: 70,542,686	W349R	probably damaging	Het
Fat3	A	T	9: 15,922,865	Y4144N	possibly damaging	Het
Gm3376	T	A	Y: 3,774,915		probably null	Het
Gm37240	A	G	3: 84,497,738	*253Q	probably null	Het
Gm498	T	C	7: 143,891,819	I201T	probably benign	Het
Itsn2	A	G	12: 4,701,337	E1309G	probably benign	Het
Macf1	T	C	4: 123,474,275	D2231G	probably benign	Het
Mtnr1a	T	C	8: 45,085,638	S38P	probably benign	Het
Olfr1417	A	G	19: 11,828,232	S265P	probably damaging	Het
Olfr745	G	T	14: 50,642,754	V152F	probably benign	Het
Olfr958	C	G	9: 39,550,415	G152A	possibly damaging	Het
Olfr958	C	A	9: 39,550,416	G152*	probably null	Het
Pcdhb9	G	A	18: 37,402,848	G632S	probably damaging	Het
Pgr	C	A	9: 8,958,448	L819I	probably benign	Het
Phrf1	T	C	7: 141,258,235	S448P	unknown	Het
Pip5k1a	A	G	3: 95,064,384	M471T	probably benign	Het
Postn	A	G	3: 54,389,339	D758G	probably damaging	Het
Rpl3	T	C	15: 80,079,701	I280V	probably benign	Het
Rtl1	A	T	12: 109,595,058	S116T	probably benign	Het
Six5	A	G	7: 19,095,124	H163R	probably benign	Het
Smarca4	A	G	9: 21,634,868	D114G	possibly damaging	Het
Tex46	C	T	4: 136,610,497		probably benign	Het
Tmem144	A	G	3: 79,836,232		probably null	Het
Unc5d	T	C	8: 28,696,425	T617A	probably benign	Het
Vmn1r74	T	A	7: 11,846,976	S68T	probably benign	Het
Zfp184	G	A	13: 21,960,047	R641Q	probably benign	Het
Zfp583	C	T	7: 6,316,420	R531H	probably benign	Het
Zfp764	T	C	7: 127,404,690	E423G	possibly damaging	Het

Other mutations in Ildr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02501:Ildr1	APN	16	36722350	missense	probably damaging	1.00
IGL02505:Ildr1	APN	16	36716164	missense	probably damaging	1.00
R0295:Ildr1	UTSW	16	36709477	critical splice acceptor site	probably null
R1649:Ildr1	UTSW	16	36708319	missense	probably damaging	1.00
R1728:Ildr1	UTSW	16	36708336	missense	possibly damaging	0.80
R1990:Ildr1	UTSW	16	36716206	missense	probably damaging	0.99
R2020:Ildr1	UTSW	16	36725541	missense	probably damaging	0.97
R2110:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R2111:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R4755:Ildr1	UTSW	16	36722021	missense	probably benign	0.00
R4798:Ildr1	UTSW	16	36722555	missense	possibly damaging	0.66
R4973:Ildr1	UTSW	16	36708298	missense	probably benign	0.10
R5014:Ildr1	UTSW	16	36721559	missense	probably damaging	0.98
R5426:Ildr1	UTSW	16	36709619	missense	probably damaging	1.00
R5957:Ildr1	UTSW	16	36725534	makesense	probably null
R7058:Ildr1	UTSW	16	36722368	missense	probably benign	0.01
R7646:Ildr1	UTSW	16	36721919	missense	possibly damaging	0.78
R8245:Ildr1	UTSW	16	36709521	missense	probably damaging	1.00
R8392:Ildr1	UTSW	16	36722358	nonsense	probably null
R8392:Ildr1	UTSW	16	36722359	missense	probably damaging	1.00
R8791:Ildr1	UTSW	16	36708400	missense	probably damaging	0.96
R8854:Ildr1	UTSW	16	36715548	missense	probably damaging	1.00
R9108:Ildr1	UTSW	16	36715557	missense	probably benign	0.13
R9252:Ildr1	UTSW	16	36716212	missense	probably damaging	1.00
R9372:Ildr1	UTSW	16	36722359	missense	probably damaging	1.00
R9434:Ildr1	UTSW	16	36709500	missense	probably damaging	1.00
R9642:Ildr1	UTSW	16	36716128	missense	probably damaging	1.00
R9681:Ildr1	UTSW	16	36708387	missense	probably damaging	1.00
R9707:Ildr1	UTSW	16	36709530	missense	probably damaging	1.00
R9777:Ildr1	UTSW	16	36708297	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- ACACTGCGATCTGAGTGAGC -3'
(R):5'- AGGCCAGTTTGGAGACTGTG -3'

Sequencing Primer
(F):5'- ATCTGAGTGAGCGCCCGAG -3'
(R):5'- TGGAGACTGTGAGCGGC -3'

Posted On

2021-03-08