Incidental Mutation 'R8749:Uck1'
ID 663683
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Name uridine-cytidine kinase 1
Synonyms URK1
MMRRC Submission 068592-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8749 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32145014-32150117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32146524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 185 (Y185C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002625
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036473
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550
AA Change: Y185C

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 C T 13: 4,320,155 (GRCm39) probably benign Het
Ap3b1 T A 13: 94,664,725 (GRCm39) M888K unknown Het
Arhgap23 T A 11: 97,391,641 (GRCm39) V223E probably damaging Het
Atm C T 9: 53,410,497 (GRCm39) W1028* probably null Het
Atp7b A G 8: 22,518,334 (GRCm39) V168A probably damaging Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Caskin1 C T 17: 24,723,774 (GRCm39) A854V probably benign Het
Cdcp1 T C 9: 123,019,027 (GRCm39) N84S probably benign Het
Cdh20 T A 1: 110,027,009 (GRCm39) I475N probably damaging Het
Ciz1 A T 2: 32,255,848 (GRCm39) Y107F probably benign Het
Creb3l4 T C 3: 90,145,199 (GRCm39) N318D probably benign Het
Dmrt3 G A 19: 25,588,550 (GRCm39) A130T probably benign Het
Dmxl1 A T 18: 50,088,937 (GRCm39) K2805N probably damaging Het
Dusp15 T A 2: 152,788,209 (GRCm39) I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 (GRCm39) Q3462R probably benign Het
Evpl A G 11: 116,120,232 (GRCm39) C569R probably benign Het
Fmnl3 A T 15: 99,219,322 (GRCm39) M766K possibly damaging Het
G6pc2 A G 2: 69,057,140 (GRCm39) N262S probably damaging Het
Galk1 A T 11: 115,899,762 (GRCm39) L325Q probably damaging Het
H3c3 T C 13: 23,929,108 (GRCm39) I125V probably benign Het
Hr G A 14: 70,795,510 (GRCm39) G352R probably damaging Het
Il12b A T 11: 44,294,864 (GRCm39) M1L not run Het
Lpar6 A T 14: 73,476,950 (GRCm39) M304L probably benign Het
Mpeg1 G A 19: 12,439,291 (GRCm39) A250T probably benign Het
Mtcl3 T C 10: 29,072,721 (GRCm39) I671T possibly damaging Het
Neb T C 2: 52,180,863 (GRCm39) K1221R probably benign Het
Ogfrl1 T A 1: 23,409,399 (GRCm39) I276F probably damaging Het
Or4f62 A G 2: 111,986,869 (GRCm39) D191G possibly damaging Het
Or4k37 T C 2: 111,158,817 (GRCm39) C18R possibly damaging Het
Or4x12-ps1 T C 2: 89,916,631 (GRCm39) Y58C probably damaging Het
Oxr1 A G 15: 41,574,260 (GRCm39) N2S probably benign Het
P3h3 G A 6: 124,822,940 (GRCm39) R505C probably damaging Het
Pcdhb16 A T 18: 37,612,392 (GRCm39) I451F possibly damaging Het
Pet117 C A 2: 144,215,122 (GRCm39) D36E probably benign Het
Prf1 T C 10: 61,138,948 (GRCm39) V302A probably damaging Het
Prkdc G A 16: 15,601,029 (GRCm39) A2897T possibly damaging Het
Prkra A G 2: 76,460,879 (GRCm39) L273P probably damaging Het
Prr30 T A 14: 101,436,365 (GRCm39) T66S probably benign Het
Slc29a4 A G 5: 142,700,819 (GRCm39) Y188C probably damaging Het
Spink5 A T 18: 44,122,425 (GRCm39) K297* probably null Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tmem100 G A 11: 89,926,574 (GRCm39) A134T probably damaging Het
Tmem132c A G 5: 127,437,003 (GRCm39) D164G possibly damaging Het
Tnfsf18 A G 1: 161,331,047 (GRCm39) T66A possibly damaging Het
Ubr4 C T 4: 139,129,935 (GRCm39) T685I probably damaging Het
Umod T A 7: 119,070,639 (GRCm39) I418F probably benign Het
Upp1 A T 11: 9,079,561 (GRCm39) S41C probably damaging Het
Vmn1r168 A T 7: 23,240,428 (GRCm39) Y95F probably benign Het
Vmn1r180 G T 7: 23,652,415 (GRCm39) D193Y probably damaging Het
Vmn2r11 A G 5: 109,195,319 (GRCm39) V669A probably damaging Het
Vmn2r55 T A 7: 12,385,796 (GRCm39) Y728F probably damaging Het
Vmn2r78 A G 7: 86,603,513 (GRCm39) T564A possibly damaging Het
Vps13d T A 4: 144,865,183 (GRCm39) N2057I Het
Wdfy3 C T 5: 102,030,446 (GRCm39) R2354Q probably damaging Het
Wdr77 T A 3: 105,866,975 (GRCm39) C26S probably damaging Het
Yif1b C T 7: 28,946,690 (GRCm39) A267V probably benign Het
Zfp316 A G 5: 143,248,565 (GRCm39) V227A unknown Het
Zfp600 T A 4: 146,133,151 (GRCm39) H606Q unknown Het
Zfp804a T C 2: 82,087,919 (GRCm39) W583R probably benign Het
Zfp961 T C 8: 72,719,686 (GRCm39) W39R probably damaging Het
Zfp990 T A 4: 145,264,156 (GRCm39) C385S probably damaging Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32,149,681 (GRCm39) missense probably damaging 1.00
IGL01765:Uck1 APN 2 32,148,688 (GRCm39) unclassified probably benign
IGL02028:Uck1 APN 2 32,148,149 (GRCm39) missense probably damaging 1.00
IGL02863:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
IGL03114:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
IGL03159:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
IGL03325:Uck1 APN 2 32,148,334 (GRCm39) missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32,146,046 (GRCm39) missense probably damaging 1.00
R1019:Uck1 UTSW 2 32,146,205 (GRCm39) missense possibly damaging 0.88
R1332:Uck1 UTSW 2 32,149,666 (GRCm39) missense probably damaging 1.00
R1336:Uck1 UTSW 2 32,149,666 (GRCm39) missense probably damaging 1.00
R1428:Uck1 UTSW 2 32,148,367 (GRCm39) missense probably damaging 1.00
R2173:Uck1 UTSW 2 32,146,088 (GRCm39) unclassified probably benign
R2233:Uck1 UTSW 2 32,148,315 (GRCm39) missense probably damaging 1.00
R2234:Uck1 UTSW 2 32,148,315 (GRCm39) missense probably damaging 1.00
R2938:Uck1 UTSW 2 32,146,088 (GRCm39) unclassified probably benign
R3079:Uck1 UTSW 2 32,148,089 (GRCm39) unclassified probably benign
R4667:Uck1 UTSW 2 32,146,046 (GRCm39) missense probably damaging 1.00
R5036:Uck1 UTSW 2 32,148,478 (GRCm39) unclassified probably benign
R6463:Uck1 UTSW 2 32,148,667 (GRCm39) missense probably benign 0.00
R7072:Uck1 UTSW 2 32,148,178 (GRCm39) missense probably damaging 1.00
R7690:Uck1 UTSW 2 32,148,184 (GRCm39) missense probably benign 0.03
R8021:Uck1 UTSW 2 32,149,929 (GRCm39) missense probably benign 0.17
R8415:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8416:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8437:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8438:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8440:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8442:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8530:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R8537:Uck1 UTSW 2 32,150,153 (GRCm39) unclassified probably benign
R9494:Uck1 UTSW 2 32,148,179 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACAGCAGTCCTGATCAGC -3'
(R):5'- CTGTGCCTGAGTACCTTAAAGTG -3'

Sequencing Primer
(F):5'- AGTCCTGATCAGCCAGCCTTATG -3'
(R):5'- TGCCTGAGTACCTTAAAGTGACCAG -3'
Posted On 2021-03-08