Incidental Mutation 'R8749:Blm'
ID663710
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8749 (G1)
Quality Score130.467
Status Not validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCCGCC to TCCGCCGCC at 80512901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably benign
Transcript: ENSMUST00000081314
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170315
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T A 13: 94,528,217 M888K unknown Het
Arhgap23 T A 11: 97,500,815 V223E probably damaging Het
Atm C T 9: 53,499,197 W1028* probably null Het
Atp7b A G 8: 22,028,318 V168A probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Caskin1 C T 17: 24,504,800 A854V probably benign Het
Cdcp1 T C 9: 123,189,962 N84S probably benign Het
Cdh7 T A 1: 110,099,279 I475N probably damaging Het
Ciz1 A T 2: 32,365,836 Y107F probably benign Het
Creb3l4 T C 3: 90,237,892 N318D probably benign Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dmxl1 A T 18: 49,955,870 K2805N probably damaging Het
Dusp15 T A 2: 152,946,289 I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 Q3462R probably benign Het
Evpl A G 11: 116,229,406 C569R probably benign Het
Fmnl3 A T 15: 99,321,441 M766K possibly damaging Het
G6pc2 A G 2: 69,226,796 N262S probably damaging Het
Galk1 A T 11: 116,008,936 L325Q probably damaging Het
Hist1h3c T C 13: 23,745,125 I125V probably benign Het
Hr G A 14: 70,558,070 G352R probably damaging Het
Il12b A T 11: 44,404,037 M1L not run Het
Lpar6 A T 14: 73,239,510 M304L probably benign Het
Mpeg1 G A 19: 12,461,927 A250T probably benign Het
Neb T C 2: 52,290,851 K1221R probably benign Het
Ogfrl1 T A 1: 23,370,318 I276F probably damaging Het
Olfr1267-ps1 T C 2: 90,086,287 Y58C probably damaging Het
Olfr1281 T C 2: 111,328,472 C18R possibly damaging Het
Olfr1318 A G 2: 112,156,524 D191G possibly damaging Het
Oxr1 A G 15: 41,710,864 N2S probably benign Het
P3h3 G A 6: 124,845,977 R505C probably damaging Het
Pcdhb16 A T 18: 37,479,339 I451F possibly damaging Het
Pet117 C A 2: 144,373,202 D36E probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Prkdc G A 16: 15,783,165 A2897T possibly damaging Het
Prkra A G 2: 76,630,535 L273P probably damaging Het
Prr30 T A 14: 101,198,929 T66S probably benign Het
Slc29a4 A G 5: 142,715,064 Y188C probably damaging Het
Soga3 T C 10: 29,196,725 I671T possibly damaging Het
Spink5 A T 18: 43,989,358 K297* probably null Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem100 G A 11: 90,035,748 A134T probably damaging Het
Tmem132c A G 5: 127,359,939 D164G possibly damaging Het
Tnfsf18 A G 1: 161,503,478 T66A possibly damaging Het
Ubr4 C T 4: 139,402,624 T685I probably damaging Het
Uck1 T C 2: 32,256,512 Y185C Het
Umod T A 7: 119,471,416 I418F probably benign Het
Upp1 A T 11: 9,129,561 S41C probably damaging Het
Vmn1r168 A T 7: 23,541,003 Y95F probably benign Het
Vmn1r180 G T 7: 23,952,990 D193Y probably damaging Het
Vmn2r11 A G 5: 109,047,453 V669A probably damaging Het
Vmn2r55 T A 7: 12,651,869 Y728F probably damaging Het
Vmn2r78 A G 7: 86,954,305 T564A possibly damaging Het
Vps13d T A 4: 145,138,613 N2057I Het
Wdfy3 C T 5: 101,882,580 R2354Q probably damaging Het
Wdr77 T A 3: 105,959,659 C26S probably damaging Het
Yif1b C T 7: 29,247,265 A267V probably benign Het
Zfp316 A G 5: 143,262,810 V227A unknown Het
Zfp600 T A 4: 146,196,581 H606Q unknown Het
Zfp804a T C 2: 82,257,575 W583R probably benign Het
Zfp961 T C 8: 71,965,842 W39R probably damaging Het
Zfp990 T A 4: 145,537,586 C385S probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8500:Blm UTSW 7 80455284 missense probably damaging 1.00
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8774:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512910 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACAACTGTCCTGTGTACCG -3'
(R):5'- ATGCGTTTGCTTCACTGGC -3'

Sequencing Primer
(F):5'- GCTCCCAGTGCTCAGCTTTAG -3'
(R):5'- GCTTCACTGGCTAAAAATCCTG -3'
Posted On2021-03-08