Incidental Mutation 'R8749:Vmn2r78'
ID663711
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8749 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86954305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 564 (T564A)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170835
AA Change: T564A

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: T564A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T A 13: 94,528,217 M888K unknown Het
Arhgap23 T A 11: 97,500,815 V223E probably damaging Het
Atm C T 9: 53,499,197 W1028* probably null Het
Atp7b A G 8: 22,028,318 V168A probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Blm TCCGCC TCCGCCGCC 7: 80,512,901 probably benign Het
Caskin1 C T 17: 24,504,800 A854V probably benign Het
Cdcp1 T C 9: 123,189,962 N84S probably benign Het
Cdh7 T A 1: 110,099,279 I475N probably damaging Het
Ciz1 A T 2: 32,365,836 Y107F probably benign Het
Creb3l4 T C 3: 90,237,892 N318D probably benign Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dmxl1 A T 18: 49,955,870 K2805N probably damaging Het
Dusp15 T A 2: 152,946,289 I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 Q3462R probably benign Het
Evpl A G 11: 116,229,406 C569R probably benign Het
Fmnl3 A T 15: 99,321,441 M766K possibly damaging Het
G6pc2 A G 2: 69,226,796 N262S probably damaging Het
Galk1 A T 11: 116,008,936 L325Q probably damaging Het
Hist1h3c T C 13: 23,745,125 I125V probably benign Het
Hr G A 14: 70,558,070 G352R probably damaging Het
Il12b A T 11: 44,404,037 M1L not run Het
Lpar6 A T 14: 73,239,510 M304L probably benign Het
Mpeg1 G A 19: 12,461,927 A250T probably benign Het
Neb T C 2: 52,290,851 K1221R probably benign Het
Ogfrl1 T A 1: 23,370,318 I276F probably damaging Het
Olfr1267-ps1 T C 2: 90,086,287 Y58C probably damaging Het
Olfr1281 T C 2: 111,328,472 C18R possibly damaging Het
Olfr1318 A G 2: 112,156,524 D191G possibly damaging Het
Oxr1 A G 15: 41,710,864 N2S probably benign Het
P3h3 G A 6: 124,845,977 R505C probably damaging Het
Pcdhb16 A T 18: 37,479,339 I451F possibly damaging Het
Pet117 C A 2: 144,373,202 D36E probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Prkdc G A 16: 15,783,165 A2897T possibly damaging Het
Prkra A G 2: 76,630,535 L273P probably damaging Het
Prr30 T A 14: 101,198,929 T66S probably benign Het
Slc29a4 A G 5: 142,715,064 Y188C probably damaging Het
Soga3 T C 10: 29,196,725 I671T possibly damaging Het
Spink5 A T 18: 43,989,358 K297* probably null Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem100 G A 11: 90,035,748 A134T probably damaging Het
Tmem132c A G 5: 127,359,939 D164G possibly damaging Het
Tnfsf18 A G 1: 161,503,478 T66A possibly damaging Het
Ubr4 C T 4: 139,402,624 T685I probably damaging Het
Uck1 T C 2: 32,256,512 Y185C Het
Umod T A 7: 119,471,416 I418F probably benign Het
Upp1 A T 11: 9,129,561 S41C probably damaging Het
Vmn1r168 A T 7: 23,541,003 Y95F probably benign Het
Vmn1r180 G T 7: 23,952,990 D193Y probably damaging Het
Vmn2r11 A G 5: 109,047,453 V669A probably damaging Het
Vmn2r55 T A 7: 12,651,869 Y728F probably damaging Het
Vps13d T A 4: 145,138,613 N2057I Het
Wdfy3 C T 5: 101,882,580 R2354Q probably damaging Het
Wdr77 T A 3: 105,959,659 C26S probably damaging Het
Yif1b C T 7: 29,247,265 A267V probably benign Het
Zfp316 A G 5: 143,262,810 V227A unknown Het
Zfp600 T A 4: 146,196,581 H606Q unknown Het
Zfp804a T C 2: 82,257,575 W583R probably benign Het
Zfp961 T C 8: 71,965,842 W39R probably damaging Het
Zfp990 T A 4: 145,537,586 C385S probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGAGCATTGGAAATTAAGATCAC -3'
(R):5'- GGACATAGCTGAGAGTTTCATTATTG -3'

Sequencing Primer
(F):5'- GCATAGGTTTGGTATATCTTCT -3'
(R):5'- AGAGTTTCATTATTGGCCTTGAC -3'
Posted On2021-03-08