Incidental Mutation 'R8749:Vmn2r78'
ID 663711
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 068592-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8749 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86564557-86604385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86603513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 564 (T564A)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170835
AA Change: T564A

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: T564A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 C T 13: 4,320,155 (GRCm39) probably benign Het
Ap3b1 T A 13: 94,664,725 (GRCm39) M888K unknown Het
Arhgap23 T A 11: 97,391,641 (GRCm39) V223E probably damaging Het
Atm C T 9: 53,410,497 (GRCm39) W1028* probably null Het
Atp7b A G 8: 22,518,334 (GRCm39) V168A probably damaging Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Caskin1 C T 17: 24,723,774 (GRCm39) A854V probably benign Het
Cdcp1 T C 9: 123,019,027 (GRCm39) N84S probably benign Het
Cdh20 T A 1: 110,027,009 (GRCm39) I475N probably damaging Het
Ciz1 A T 2: 32,255,848 (GRCm39) Y107F probably benign Het
Creb3l4 T C 3: 90,145,199 (GRCm39) N318D probably benign Het
Dmrt3 G A 19: 25,588,550 (GRCm39) A130T probably benign Het
Dmxl1 A T 18: 50,088,937 (GRCm39) K2805N probably damaging Het
Dusp15 T A 2: 152,788,209 (GRCm39) I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 (GRCm39) Q3462R probably benign Het
Evpl A G 11: 116,120,232 (GRCm39) C569R probably benign Het
Fmnl3 A T 15: 99,219,322 (GRCm39) M766K possibly damaging Het
G6pc2 A G 2: 69,057,140 (GRCm39) N262S probably damaging Het
Galk1 A T 11: 115,899,762 (GRCm39) L325Q probably damaging Het
H3c3 T C 13: 23,929,108 (GRCm39) I125V probably benign Het
Hr G A 14: 70,795,510 (GRCm39) G352R probably damaging Het
Il12b A T 11: 44,294,864 (GRCm39) M1L not run Het
Lpar6 A T 14: 73,476,950 (GRCm39) M304L probably benign Het
Mpeg1 G A 19: 12,439,291 (GRCm39) A250T probably benign Het
Mtcl3 T C 10: 29,072,721 (GRCm39) I671T possibly damaging Het
Neb T C 2: 52,180,863 (GRCm39) K1221R probably benign Het
Ogfrl1 T A 1: 23,409,399 (GRCm39) I276F probably damaging Het
Or4f62 A G 2: 111,986,869 (GRCm39) D191G possibly damaging Het
Or4k37 T C 2: 111,158,817 (GRCm39) C18R possibly damaging Het
Or4x12-ps1 T C 2: 89,916,631 (GRCm39) Y58C probably damaging Het
Oxr1 A G 15: 41,574,260 (GRCm39) N2S probably benign Het
P3h3 G A 6: 124,822,940 (GRCm39) R505C probably damaging Het
Pcdhb16 A T 18: 37,612,392 (GRCm39) I451F possibly damaging Het
Pet117 C A 2: 144,215,122 (GRCm39) D36E probably benign Het
Prf1 T C 10: 61,138,948 (GRCm39) V302A probably damaging Het
Prkdc G A 16: 15,601,029 (GRCm39) A2897T possibly damaging Het
Prkra A G 2: 76,460,879 (GRCm39) L273P probably damaging Het
Prr30 T A 14: 101,436,365 (GRCm39) T66S probably benign Het
Slc29a4 A G 5: 142,700,819 (GRCm39) Y188C probably damaging Het
Spink5 A T 18: 44,122,425 (GRCm39) K297* probably null Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tmem100 G A 11: 89,926,574 (GRCm39) A134T probably damaging Het
Tmem132c A G 5: 127,437,003 (GRCm39) D164G possibly damaging Het
Tnfsf18 A G 1: 161,331,047 (GRCm39) T66A possibly damaging Het
Ubr4 C T 4: 139,129,935 (GRCm39) T685I probably damaging Het
Uck1 T C 2: 32,146,524 (GRCm39) Y185C Het
Umod T A 7: 119,070,639 (GRCm39) I418F probably benign Het
Upp1 A T 11: 9,079,561 (GRCm39) S41C probably damaging Het
Vmn1r168 A T 7: 23,240,428 (GRCm39) Y95F probably benign Het
Vmn1r180 G T 7: 23,652,415 (GRCm39) D193Y probably damaging Het
Vmn2r11 A G 5: 109,195,319 (GRCm39) V669A probably damaging Het
Vmn2r55 T A 7: 12,385,796 (GRCm39) Y728F probably damaging Het
Vps13d T A 4: 144,865,183 (GRCm39) N2057I Het
Wdfy3 C T 5: 102,030,446 (GRCm39) R2354Q probably damaging Het
Wdr77 T A 3: 105,866,975 (GRCm39) C26S probably damaging Het
Yif1b C T 7: 28,946,690 (GRCm39) A267V probably benign Het
Zfp316 A G 5: 143,248,565 (GRCm39) V227A unknown Het
Zfp600 T A 4: 146,133,151 (GRCm39) H606Q unknown Het
Zfp804a T C 2: 82,087,919 (GRCm39) W583R probably benign Het
Zfp961 T C 8: 72,719,686 (GRCm39) W39R probably damaging Het
Zfp990 T A 4: 145,264,156 (GRCm39) C385S probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86,564,569 (GRCm39) missense unknown
IGL01473:Vmn2r78 APN 7 86,569,520 (GRCm39) missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86,603,643 (GRCm39) missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86,570,687 (GRCm39) missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86,603,496 (GRCm39) missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86,569,969 (GRCm39) nonsense probably null
ANU74:Vmn2r78 UTSW 7 86,570,273 (GRCm39) missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86,569,413 (GRCm39) missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86,572,235 (GRCm39) missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86,570,519 (GRCm39) missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86,603,588 (GRCm39) missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86,571,477 (GRCm39) missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86,564,615 (GRCm39) missense unknown
R1526:Vmn2r78 UTSW 7 86,571,465 (GRCm39) splice site probably null
R1712:Vmn2r78 UTSW 7 86,604,132 (GRCm39) missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86,569,997 (GRCm39) missense probably benign
R1812:Vmn2r78 UTSW 7 86,569,995 (GRCm39) missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86,604,287 (GRCm39) missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86,603,690 (GRCm39) missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86,570,535 (GRCm39) missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86,569,362 (GRCm39) missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86,569,953 (GRCm39) splice site probably benign
R3023:Vmn2r78 UTSW 7 86,604,174 (GRCm39) missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86,569,959 (GRCm39) critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86,569,452 (GRCm39) missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86,570,399 (GRCm39) missense probably benign
R4546:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86,603,916 (GRCm39) missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86,603,835 (GRCm39) missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86,571,563 (GRCm39) missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86,569,332 (GRCm39) missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86,570,238 (GRCm39) missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86,569,330 (GRCm39) missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86,570,737 (GRCm39) missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86,564,720 (GRCm39) missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86,603,637 (GRCm39) missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86,603,796 (GRCm39) missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86,604,115 (GRCm39) missense probably benign 0.00
R5977:Vmn2r78 UTSW 7 86,569,541 (GRCm39) missense possibly damaging 0.74
R6276:Vmn2r78 UTSW 7 86,570,318 (GRCm39) missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86,571,545 (GRCm39) nonsense probably null
R6724:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86,571,558 (GRCm39) missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86,571,633 (GRCm39) missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86,603,552 (GRCm39) nonsense probably null
R7680:Vmn2r78 UTSW 7 86,604,149 (GRCm39) missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86,570,343 (GRCm39) missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86,569,378 (GRCm39) nonsense probably null
R8031:Vmn2r78 UTSW 7 86,604,075 (GRCm39) missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86,571,695 (GRCm39) missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86,603,998 (GRCm39) missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86,603,660 (GRCm39) missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86,570,094 (GRCm39) missense probably damaging 0.99
R9209:Vmn2r78 UTSW 7 86,569,431 (GRCm39) missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86,603,639 (GRCm39) nonsense probably null
Z1177:Vmn2r78 UTSW 7 86,603,982 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r78 UTSW 7 86,570,415 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTGGAGCATTGGAAATTAAGATCAC -3'
(R):5'- GGACATAGCTGAGAGTTTCATTATTG -3'

Sequencing Primer
(F):5'- GCATAGGTTTGGTATATCTTCT -3'
(R):5'- AGAGTTTCATTATTGGCCTTGAC -3'
Posted On 2021-03-08