Incidental Mutation 'R8749:Arhgap23'
ID663723
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8749 (G1)
Quality Score112.008
Status Not validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97500815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 223 (V223E)
Ref Sequence ENSEMBL: ENSMUSP00000091472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056955] [ENSMUST00000093940] [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect probably benign
Transcript: ENSMUST00000056955
SMART Domains Protein: ENSMUSP00000060323
Gene: ENSMUSG00000047988

DomainStartEndE-ValueType
low complexity region 77 100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093940
AA Change: V223E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091472
Gene: ENSMUSG00000049807
AA Change: V223E

DomainStartEndE-ValueType
Blast:RhoGAP 72 123 3e-6 BLAST
low complexity region 149 162 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107601
AA Change: V1175E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: V1175E

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121799
AA Change: V1386E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: V1386E

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T A 13: 94,528,217 M888K unknown Het
Atm C T 9: 53,499,197 W1028* probably null Het
Atp7b A G 8: 22,028,318 V168A probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Blm TCCGCC TCCGCCGCC 7: 80,512,901 probably benign Het
Caskin1 C T 17: 24,504,800 A854V probably benign Het
Cdcp1 T C 9: 123,189,962 N84S probably benign Het
Cdh7 T A 1: 110,099,279 I475N probably damaging Het
Ciz1 A T 2: 32,365,836 Y107F probably benign Het
Creb3l4 T C 3: 90,237,892 N318D probably benign Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dmxl1 A T 18: 49,955,870 K2805N probably damaging Het
Dusp15 T A 2: 152,946,289 I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 Q3462R probably benign Het
Evpl A G 11: 116,229,406 C569R probably benign Het
Fmnl3 A T 15: 99,321,441 M766K possibly damaging Het
G6pc2 A G 2: 69,226,796 N262S probably damaging Het
Galk1 A T 11: 116,008,936 L325Q probably damaging Het
Hist1h3c T C 13: 23,745,125 I125V probably benign Het
Hr G A 14: 70,558,070 G352R probably damaging Het
Il12b A T 11: 44,404,037 M1L not run Het
Lpar6 A T 14: 73,239,510 M304L probably benign Het
Mpeg1 G A 19: 12,461,927 A250T probably benign Het
Neb T C 2: 52,290,851 K1221R probably benign Het
Ogfrl1 T A 1: 23,370,318 I276F probably damaging Het
Olfr1267-ps1 T C 2: 90,086,287 Y58C probably damaging Het
Olfr1281 T C 2: 111,328,472 C18R possibly damaging Het
Olfr1318 A G 2: 112,156,524 D191G possibly damaging Het
Oxr1 A G 15: 41,710,864 N2S probably benign Het
P3h3 G A 6: 124,845,977 R505C probably damaging Het
Pcdhb16 A T 18: 37,479,339 I451F possibly damaging Het
Pet117 C A 2: 144,373,202 D36E probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Prkdc G A 16: 15,783,165 A2897T possibly damaging Het
Prkra A G 2: 76,630,535 L273P probably damaging Het
Prr30 T A 14: 101,198,929 T66S probably benign Het
Slc29a4 A G 5: 142,715,064 Y188C probably damaging Het
Soga3 T C 10: 29,196,725 I671T possibly damaging Het
Spink5 A T 18: 43,989,358 K297* probably null Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem100 G A 11: 90,035,748 A134T probably damaging Het
Tmem132c A G 5: 127,359,939 D164G possibly damaging Het
Tnfsf18 A G 1: 161,503,478 T66A possibly damaging Het
Ubr4 C T 4: 139,402,624 T685I probably damaging Het
Uck1 T C 2: 32,256,512 Y185C Het
Umod T A 7: 119,471,416 I418F probably benign Het
Upp1 A T 11: 9,129,561 S41C probably damaging Het
Vmn1r168 A T 7: 23,541,003 Y95F probably benign Het
Vmn1r180 G T 7: 23,952,990 D193Y probably damaging Het
Vmn2r11 A G 5: 109,047,453 V669A probably damaging Het
Vmn2r55 T A 7: 12,651,869 Y728F probably damaging Het
Vmn2r78 A G 7: 86,954,305 T564A possibly damaging Het
Vps13d T A 4: 145,138,613 N2057I Het
Wdfy3 C T 5: 101,882,580 R2354Q probably damaging Het
Wdr77 T A 3: 105,959,659 C26S probably damaging Het
Yif1b C T 7: 29,247,265 A267V probably benign Het
Zfp316 A G 5: 143,262,810 V227A unknown Het
Zfp600 T A 4: 146,196,581 H606Q unknown Het
Zfp804a T C 2: 82,257,575 W583R probably benign Het
Zfp961 T C 8: 71,965,842 W39R probably damaging Het
Zfp990 T A 4: 145,537,586 C385S probably damaging Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7209:Arhgap23 UTSW 11 97492447 splice site probably null
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
R8229:Arhgap23 UTSW 11 97453906 missense probably benign 0.36
R8412:Arhgap23 UTSW 11 97466028 missense probably benign 0.02
R8460:Arhgap23 UTSW 11 97452371 missense probably damaging 1.00
R8492:Arhgap23 UTSW 11 97475021 missense probably damaging 1.00
R8525:Arhgap23 UTSW 11 97490084 missense probably damaging 1.00
R8692:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R8708:Arhgap23 UTSW 11 97452412 missense probably benign 0.06
R8882:Arhgap23 UTSW 11 97465123 missense probably benign 0.00
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGCCATGCGACACTCTG -3'
(R):5'- AGAGTCCTTATTGTCGCTGTGC -3'

Sequencing Primer
(F):5'- ATGCGACACTCTGGCACG -3'
(R):5'- AAGTTGAGGTCGGTCAG -3'
Posted On2021-03-08