Incidental Mutation 'R8749:Bach1'
ID 663734
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene Name BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms 6230421P05Rik
MMRRC Submission 068592-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8749 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 87495842-87530234 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87516179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 240 (R240Q)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
AlphaFold P97302
PDB Structure Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026703
AA Change: R240Q

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: R240Q

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 C T 13: 4,320,155 (GRCm39) probably benign Het
Ap3b1 T A 13: 94,664,725 (GRCm39) M888K unknown Het
Arhgap23 T A 11: 97,391,641 (GRCm39) V223E probably damaging Het
Atm C T 9: 53,410,497 (GRCm39) W1028* probably null Het
Atp7b A G 8: 22,518,334 (GRCm39) V168A probably damaging Het
Caskin1 C T 17: 24,723,774 (GRCm39) A854V probably benign Het
Cdcp1 T C 9: 123,019,027 (GRCm39) N84S probably benign Het
Cdh20 T A 1: 110,027,009 (GRCm39) I475N probably damaging Het
Ciz1 A T 2: 32,255,848 (GRCm39) Y107F probably benign Het
Creb3l4 T C 3: 90,145,199 (GRCm39) N318D probably benign Het
Dmrt3 G A 19: 25,588,550 (GRCm39) A130T probably benign Het
Dmxl1 A T 18: 50,088,937 (GRCm39) K2805N probably damaging Het
Dusp15 T A 2: 152,788,209 (GRCm39) I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 (GRCm39) Q3462R probably benign Het
Evpl A G 11: 116,120,232 (GRCm39) C569R probably benign Het
Fmnl3 A T 15: 99,219,322 (GRCm39) M766K possibly damaging Het
G6pc2 A G 2: 69,057,140 (GRCm39) N262S probably damaging Het
Galk1 A T 11: 115,899,762 (GRCm39) L325Q probably damaging Het
H3c3 T C 13: 23,929,108 (GRCm39) I125V probably benign Het
Hr G A 14: 70,795,510 (GRCm39) G352R probably damaging Het
Il12b A T 11: 44,294,864 (GRCm39) M1L not run Het
Lpar6 A T 14: 73,476,950 (GRCm39) M304L probably benign Het
Mpeg1 G A 19: 12,439,291 (GRCm39) A250T probably benign Het
Mtcl3 T C 10: 29,072,721 (GRCm39) I671T possibly damaging Het
Neb T C 2: 52,180,863 (GRCm39) K1221R probably benign Het
Ogfrl1 T A 1: 23,409,399 (GRCm39) I276F probably damaging Het
Or4f62 A G 2: 111,986,869 (GRCm39) D191G possibly damaging Het
Or4k37 T C 2: 111,158,817 (GRCm39) C18R possibly damaging Het
Or4x12-ps1 T C 2: 89,916,631 (GRCm39) Y58C probably damaging Het
Oxr1 A G 15: 41,574,260 (GRCm39) N2S probably benign Het
P3h3 G A 6: 124,822,940 (GRCm39) R505C probably damaging Het
Pcdhb16 A T 18: 37,612,392 (GRCm39) I451F possibly damaging Het
Pet117 C A 2: 144,215,122 (GRCm39) D36E probably benign Het
Prf1 T C 10: 61,138,948 (GRCm39) V302A probably damaging Het
Prkdc G A 16: 15,601,029 (GRCm39) A2897T possibly damaging Het
Prkra A G 2: 76,460,879 (GRCm39) L273P probably damaging Het
Prr30 T A 14: 101,436,365 (GRCm39) T66S probably benign Het
Slc29a4 A G 5: 142,700,819 (GRCm39) Y188C probably damaging Het
Spink5 A T 18: 44,122,425 (GRCm39) K297* probably null Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tmem100 G A 11: 89,926,574 (GRCm39) A134T probably damaging Het
Tmem132c A G 5: 127,437,003 (GRCm39) D164G possibly damaging Het
Tnfsf18 A G 1: 161,331,047 (GRCm39) T66A possibly damaging Het
Ubr4 C T 4: 139,129,935 (GRCm39) T685I probably damaging Het
Uck1 T C 2: 32,146,524 (GRCm39) Y185C Het
Umod T A 7: 119,070,639 (GRCm39) I418F probably benign Het
Upp1 A T 11: 9,079,561 (GRCm39) S41C probably damaging Het
Vmn1r168 A T 7: 23,240,428 (GRCm39) Y95F probably benign Het
Vmn1r180 G T 7: 23,652,415 (GRCm39) D193Y probably damaging Het
Vmn2r11 A G 5: 109,195,319 (GRCm39) V669A probably damaging Het
Vmn2r55 T A 7: 12,385,796 (GRCm39) Y728F probably damaging Het
Vmn2r78 A G 7: 86,603,513 (GRCm39) T564A possibly damaging Het
Vps13d T A 4: 144,865,183 (GRCm39) N2057I Het
Wdfy3 C T 5: 102,030,446 (GRCm39) R2354Q probably damaging Het
Wdr77 T A 3: 105,866,975 (GRCm39) C26S probably damaging Het
Yif1b C T 7: 28,946,690 (GRCm39) A267V probably benign Het
Zfp316 A G 5: 143,248,565 (GRCm39) V227A unknown Het
Zfp600 T A 4: 146,133,151 (GRCm39) H606Q unknown Het
Zfp804a T C 2: 82,087,919 (GRCm39) W583R probably benign Het
Zfp961 T C 8: 72,719,686 (GRCm39) W39R probably damaging Het
Zfp990 T A 4: 145,264,156 (GRCm39) C385S probably damaging Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87,519,393 (GRCm39) missense probably damaging 1.00
R0626:Bach1 UTSW 16 87,526,359 (GRCm39) missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87,516,877 (GRCm39) missense probably damaging 0.99
R1070:Bach1 UTSW 16 87,517,009 (GRCm39) missense probably benign 0.02
R1160:Bach1 UTSW 16 87,512,322 (GRCm39) missense probably benign 0.34
R2066:Bach1 UTSW 16 87,526,513 (GRCm39) missense probably damaging 0.99
R2235:Bach1 UTSW 16 87,517,001 (GRCm39) missense probably damaging 1.00
R4716:Bach1 UTSW 16 87,512,267 (GRCm39) start gained probably benign
R4801:Bach1 UTSW 16 87,519,340 (GRCm39) missense probably damaging 0.99
R4802:Bach1 UTSW 16 87,519,340 (GRCm39) missense probably damaging 0.99
R4989:Bach1 UTSW 16 87,515,888 (GRCm39) missense possibly damaging 0.94
R5016:Bach1 UTSW 16 87,516,206 (GRCm39) missense possibly damaging 0.88
R5527:Bach1 UTSW 16 87,516,433 (GRCm39) missense probably benign 0.01
R5657:Bach1 UTSW 16 87,516,173 (GRCm39) missense probably benign 0.00
R6064:Bach1 UTSW 16 87,526,752 (GRCm39) missense probably damaging 1.00
R6384:Bach1 UTSW 16 87,516,745 (GRCm39) nonsense probably null
R7009:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7027:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7028:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7029:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7030:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7095:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7096:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7192:Bach1 UTSW 16 87,526,551 (GRCm39) missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87,526,385 (GRCm39) missense probably damaging 0.99
R7571:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7572:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7623:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R7632:Bach1 UTSW 16 87,517,031 (GRCm39) missense probably benign 0.00
R7714:Bach1 UTSW 16 87,515,736 (GRCm39) nonsense probably null
R7715:Bach1 UTSW 16 87,516,859 (GRCm39) missense possibly damaging 0.82
R7746:Bach1 UTSW 16 87,526,521 (GRCm39) missense probably benign 0.00
R7896:Bach1 UTSW 16 87,515,893 (GRCm39) missense possibly damaging 0.63
R8129:Bach1 UTSW 16 87,519,314 (GRCm39) missense possibly damaging 0.51
R8169:Bach1 UTSW 16 87,519,390 (GRCm39) missense possibly damaging 0.93
R8296:Bach1 UTSW 16 87,526,467 (GRCm39) missense probably damaging 1.00
R8300:Bach1 UTSW 16 87,515,996 (GRCm39) missense probably benign
R8388:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8389:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8391:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8480:Bach1 UTSW 16 87,516,163 (GRCm39) missense probably damaging 1.00
R8691:Bach1 UTSW 16 87,516,517 (GRCm39) missense probably benign
R8748:Bach1 UTSW 16 87,516,179 (GRCm39) missense probably benign 0.10
R8952:Bach1 UTSW 16 87,512,353 (GRCm39) missense probably damaging 0.99
R9255:Bach1 UTSW 16 87,519,401 (GRCm39) missense possibly damaging 0.93
R9283:Bach1 UTSW 16 87,516,211 (GRCm39) missense probably benign
R9433:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
R9434:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
R9440:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
R9487:Bach1 UTSW 16 87,526,733 (GRCm39) missense probably benign
R9501:Bach1 UTSW 16 87,515,999 (GRCm39) missense probably benign 0.00
R9557:Bach1 UTSW 16 87,516,603 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGTGTTCAGACGCCTCAG -3'
(R):5'- AATCCTGAGGCAAGGGTGTC -3'

Sequencing Primer
(F):5'- TGTTCAGACGCCTCAGTGTGAC -3'
(R):5'- CACTGAGGGGAGGGATCCTG -3'
Posted On 2021-03-08