Incidental Mutation 'R8749:Spink5'
ID 663737
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms 2310065D10Rik, LEKT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8749 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43963235-44022501 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 43989358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 297 (K297*)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect probably null
Transcript: ENSMUST00000069245
AA Change: K297*
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: K297*

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 C T 13: 4,270,156 probably benign Het
Ap3b1 T A 13: 94,528,217 M888K unknown Het
Arhgap23 T A 11: 97,500,815 V223E probably damaging Het
Atm C T 9: 53,499,197 W1028* probably null Het
Atp7b A G 8: 22,028,318 V168A probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Caskin1 C T 17: 24,504,800 A854V probably benign Het
Cdcp1 T C 9: 123,189,962 N84S probably benign Het
Cdh7 T A 1: 110,099,279 I475N probably damaging Het
Ciz1 A T 2: 32,365,836 Y107F probably benign Het
Creb3l4 T C 3: 90,237,892 N318D probably benign Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dmxl1 A T 18: 49,955,870 K2805N probably damaging Het
Dusp15 T A 2: 152,946,289 I63F probably damaging Het
Dync2h1 T C 9: 7,035,063 Q3462R probably benign Het
Evpl A G 11: 116,229,406 C569R probably benign Het
Fmnl3 A T 15: 99,321,441 M766K possibly damaging Het
G6pc2 A G 2: 69,226,796 N262S probably damaging Het
Galk1 A T 11: 116,008,936 L325Q probably damaging Het
Hist1h3c T C 13: 23,745,125 I125V probably benign Het
Hr G A 14: 70,558,070 G352R probably damaging Het
Il12b A T 11: 44,404,037 M1L not run Het
Lpar6 A T 14: 73,239,510 M304L probably benign Het
Mpeg1 G A 19: 12,461,927 A250T probably benign Het
Neb T C 2: 52,290,851 K1221R probably benign Het
Ogfrl1 T A 1: 23,370,318 I276F probably damaging Het
Olfr1267-ps1 T C 2: 90,086,287 Y58C probably damaging Het
Olfr1281 T C 2: 111,328,472 C18R possibly damaging Het
Olfr1318 A G 2: 112,156,524 D191G possibly damaging Het
Oxr1 A G 15: 41,710,864 N2S probably benign Het
P3h3 G A 6: 124,845,977 R505C probably damaging Het
Pcdhb16 A T 18: 37,479,339 I451F possibly damaging Het
Pet117 C A 2: 144,373,202 D36E probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Prkdc G A 16: 15,783,165 A2897T possibly damaging Het
Prkra A G 2: 76,630,535 L273P probably damaging Het
Prr30 T A 14: 101,198,929 T66S probably benign Het
Slc29a4 A G 5: 142,715,064 Y188C probably damaging Het
Soga3 T C 10: 29,196,725 I671T possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem100 G A 11: 90,035,748 A134T probably damaging Het
Tmem132c A G 5: 127,359,939 D164G possibly damaging Het
Tnfsf18 A G 1: 161,503,478 T66A possibly damaging Het
Ubr4 C T 4: 139,402,624 T685I probably damaging Het
Uck1 T C 2: 32,256,512 Y185C Het
Umod T A 7: 119,471,416 I418F probably benign Het
Upp1 A T 11: 9,129,561 S41C probably damaging Het
Vmn1r168 A T 7: 23,541,003 Y95F probably benign Het
Vmn1r180 G T 7: 23,952,990 D193Y probably damaging Het
Vmn2r11 A G 5: 109,047,453 V669A probably damaging Het
Vmn2r55 T A 7: 12,651,869 Y728F probably damaging Het
Vmn2r78 A G 7: 86,954,305 T564A possibly damaging Het
Vps13d T A 4: 145,138,613 N2057I Het
Wdfy3 C T 5: 101,882,580 R2354Q probably damaging Het
Wdr77 T A 3: 105,959,659 C26S probably damaging Het
Yif1b C T 7: 29,247,265 A267V probably benign Het
Zfp316 A G 5: 143,262,810 V227A unknown Het
Zfp600 T A 4: 146,196,581 H606Q unknown Het
Zfp804a T C 2: 82,257,575 W583R probably benign Het
Zfp961 T C 8: 71,965,842 W39R probably damaging Het
Zfp990 T A 4: 145,537,586 C385S probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
R8198:Spink5 UTSW 18 43992880 missense probably benign 0.17
R8361:Spink5 UTSW 18 43989462 missense probably damaging 1.00
R8375:Spink5 UTSW 18 43990719 missense probably benign 0.01
R8684:Spink5 UTSW 18 44010238 missense probably benign 0.02
R8918:Spink5 UTSW 18 43967020 missense probably damaging 0.98
R9064:Spink5 UTSW 18 43967126 missense probably damaging 1.00
R9161:Spink5 UTSW 18 44014919 missense probably damaging 1.00
R9221:Spink5 UTSW 18 43986300 missense probably damaging 1.00
R9292:Spink5 UTSW 18 44015008 missense possibly damaging 0.91
R9545:Spink5 UTSW 18 44003195 missense possibly damaging 0.88
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGTCTAGCAAAGGAAACTAAACC -3'
(R):5'- AGCTAGTCCTATAAGGCCATGTG -3'

Sequencing Primer
(F):5'- CTAGCAAAGGAAACTAAACCATCTAG -3'
(R):5'- AGGCCATGTGTAAATTTCTTCTC -3'
Posted On 2021-03-08