Incidental Mutation 'R8750:Dpyd'
ID663752
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8750 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location118562129-119432924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119141936 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 670 (S670L)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably damaging
Transcript: ENSMUST00000039177
AA Change: S670L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: S670L

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,473 Q172* probably null Het
Ankib1 A G 5: 3,702,890 probably null Het
Avpr1b C T 1: 131,599,936 R66C probably damaging Het
Bbs7 A T 3: 36,607,595 C152S possibly damaging Het
Cacna1a C A 8: 84,559,155 R810S probably damaging Het
Ccdc17 G A 4: 116,599,932 A538T possibly damaging Het
Cd93 T C 2: 148,443,160 M89V probably benign Het
Clec11a G T 7: 44,305,899 D157E probably benign Het
Crtam A C 9: 40,984,345 D228E probably benign Het
Cyp2a4 A G 7: 26,312,784 I331V probably benign Het
Cysltr2 T C 14: 73,029,638 I211V probably benign Het
Dcaf13 T C 15: 39,119,441 S123P probably damaging Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dnah1 A T 14: 31,304,967 L700Q probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dsg2 A T 18: 20,575,012 I57F possibly damaging Het
Dzip3 A C 16: 48,980,975 I62S probably damaging Het
Ern1 A T 11: 106,421,950 S202T probably damaging Het
Foxm1 T A 6: 128,373,243 C517* probably null Het
Galnt16 G A 12: 80,598,105 V501I probably benign Het
Gmip A T 8: 69,820,484 R840S probably benign Het
Gna14 A C 19: 16,608,094 I279L Het
Irak2 T C 6: 113,686,822 M444T probably benign Het
Itfg2 T C 6: 128,412,792 probably null Het
Kif5a T A 10: 127,248,040 H94L probably damaging Het
Kmt2e A G 5: 23,493,217 T636A probably benign Het
Krba1 T C 6: 48,405,278 S152P probably damaging Het
Mad1l1 T A 5: 140,315,067 M25L probably benign Het
Map7d1 T C 4: 126,238,522 N286D probably benign Het
Mfrp A G 9: 44,103,505 K280E probably benign Het
Mlh3 G T 12: 85,261,714 L1100I probably damaging Het
Mrgprx2 T C 7: 48,482,030 I347V probably benign Het
Mtnr1b A T 9: 15,874,428 C11* probably null Het
Mx1 T C 16: 97,451,717 E401G probably damaging Het
Mypn T C 10: 63,167,257 D367G probably benign Het
Olfr1013 T A 2: 85,769,963 L54H probably damaging Het
Olfr281 T G 15: 98,457,048 I246R probably damaging Het
Olfr622 T A 7: 103,639,852 D96V probably damaging Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Plcb1 T G 2: 135,335,449 M567R probably damaging Het
Plekhd1 A T 12: 80,706,087 D109V probably damaging Het
Polr2e A G 10: 80,039,590 I17T probably benign Het
Pot1b T C 17: 55,666,537 D421G probably benign Het
Prkar1b A T 5: 139,050,696 W224R probably damaging Het
Psmd1 C A 1: 86,088,863 R490S probably damaging Het
Pwp2 A G 10: 78,177,825 W521R probably damaging Het
Rhpn2 C A 7: 35,376,255 Q286K probably benign Het
Rnf103 T A 6: 71,509,618 M411K probably benign Het
Scpep1 A C 11: 88,944,472 V125G probably damaging Het
Serpinb9c C T 13: 33,151,810 V248M probably null Het
Slc9a3r2 T C 17: 24,642,259 I176V probably damaging Het
Snx15 T A 19: 6,120,563 N282I probably benign Het
Spaca3 A T 11: 80,867,688 D159V probably benign Het
Srrm4 A G 5: 116,467,508 V230A unknown Het
Ssu2 T A 6: 112,382,351 I103F possibly damaging Het
Strip2 T A 6: 29,931,816 F453I probably damaging Het
Tac2 C T 10: 127,728,450 P72L possibly damaging Het
Tiparp T G 3: 65,552,704 S473R probably damaging Het
Tmem135 C T 7: 89,307,248 R53Q probably damaging Het
Tmem200b T A 4: 131,922,095 F109I probably damaging Het
Tmem245 A T 4: 56,886,141 I825N probably damaging Het
Tmem63c G T 12: 87,056,532 V27F probably damaging Het
Tshz1 T C 18: 84,015,037 I415M probably damaging Het
Wfdc2 T A 2: 164,565,898 N162K probably damaging Het
Zcchc11 C G 4: 108,550,743 A1403G probably damaging Het
Zeb2 T A 2: 44,997,927 I373F probably damaging Het
Zfp27 T C 7: 29,895,379 N387S possibly damaging Het
Zfp760 A T 17: 21,722,375 H177L possibly damaging Het
Zg16 A G 7: 127,050,346 S148P possibly damaging Het
Zic2 A G 14: 122,476,717 N348D probably benign Het
Zswim4 A T 8: 84,212,684 D856E possibly damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGAGCAGTTTCTACAGAAGTCG -3'
(R):5'- TCTTCAGCCAGTCATCAGATCC -3'

Sequencing Primer
(F):5'- AGACAAAGTGTGGTCCCTTATG -3'
(R):5'- GTCATCAGATCCACACATCTCCTCG -3'
Posted On2021-03-08