Incidental Mutation 'R8750:Olfr622'
ID663777
Institutional Source Beutler Lab
Gene Symbol Olfr622
Ensembl Gene ENSMUSG00000050085
Gene Nameolfactory receptor 622
SynonymsMOR26-1, GA_x6K02T2PBJ9-6362863-6361910
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8750 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103638451-103642702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103639852 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 96 (D96V)
Ref Sequence ENSEMBL: ENSMUSP00000150390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058744] [ENSMUST00000213536] [ENSMUST00000216570]
Predicted Effect probably damaging
Transcript: ENSMUST00000058744
AA Change: D96V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058312
Gene: ENSMUSG00000050085
AA Change: D96V

DomainStartEndE-ValueType
Pfam:7tm_4 32 312 4.2e-100 PFAM
Pfam:7TM_GPCR_Srsx 36 308 2.3e-6 PFAM
Pfam:7tm_1 42 293 6.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213536
AA Change: D96V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216570
AA Change: D96V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,473 Q172* probably null Het
Ankib1 A G 5: 3,702,890 probably null Het
Avpr1b C T 1: 131,599,936 R66C probably damaging Het
Bbs7 A T 3: 36,607,595 C152S possibly damaging Het
Cacna1a C A 8: 84,559,155 R810S probably damaging Het
Ccdc17 G A 4: 116,599,932 A538T possibly damaging Het
Cd93 T C 2: 148,443,160 M89V probably benign Het
Clec11a G T 7: 44,305,899 D157E probably benign Het
Crtam A C 9: 40,984,345 D228E probably benign Het
Cyp2a4 A G 7: 26,312,784 I331V probably benign Het
Cysltr2 T C 14: 73,029,638 I211V probably benign Het
Dcaf13 T C 15: 39,119,441 S123P probably damaging Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dnah1 A T 14: 31,304,967 L700Q probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dpyd C T 3: 119,141,936 S670L probably damaging Het
Dsg2 A T 18: 20,575,012 I57F possibly damaging Het
Dzip3 A C 16: 48,980,975 I62S probably damaging Het
Ern1 A T 11: 106,421,950 S202T probably damaging Het
Foxm1 T A 6: 128,373,243 C517* probably null Het
Galnt16 G A 12: 80,598,105 V501I probably benign Het
Gmip A T 8: 69,820,484 R840S probably benign Het
Gna14 A C 19: 16,608,094 I279L Het
Irak2 T C 6: 113,686,822 M444T probably benign Het
Itfg2 T C 6: 128,412,792 probably null Het
Kif5a T A 10: 127,248,040 H94L probably damaging Het
Kmt2e A G 5: 23,493,217 T636A probably benign Het
Krba1 T C 6: 48,405,278 S152P probably damaging Het
Mad1l1 T A 5: 140,315,067 M25L probably benign Het
Map7d1 T C 4: 126,238,522 N286D probably benign Het
Mfrp A G 9: 44,103,505 K280E probably benign Het
Mlh3 G T 12: 85,261,714 L1100I probably damaging Het
Mrgprx2 T C 7: 48,482,030 I347V probably benign Het
Mtnr1b A T 9: 15,874,428 C11* probably null Het
Mx1 T C 16: 97,451,717 E401G probably damaging Het
Mypn T C 10: 63,167,257 D367G probably benign Het
Olfr1013 T A 2: 85,769,963 L54H probably damaging Het
Olfr281 T G 15: 98,457,048 I246R probably damaging Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Plcb1 T G 2: 135,335,449 M567R probably damaging Het
Plekhd1 A T 12: 80,706,087 D109V probably damaging Het
Polr2e A G 10: 80,039,590 I17T probably benign Het
Pot1b T C 17: 55,666,537 D421G probably benign Het
Prkar1b A T 5: 139,050,696 W224R probably damaging Het
Psmd1 C A 1: 86,088,863 R490S probably damaging Het
Pwp2 A G 10: 78,177,825 W521R probably damaging Het
Rhpn2 C A 7: 35,376,255 Q286K probably benign Het
Rnf103 T A 6: 71,509,618 M411K probably benign Het
Scpep1 A C 11: 88,944,472 V125G probably damaging Het
Serpinb9c C T 13: 33,151,810 V248M probably null Het
Slc9a3r2 T C 17: 24,642,259 I176V probably damaging Het
Snx15 T A 19: 6,120,563 N282I probably benign Het
Spaca3 A T 11: 80,867,688 D159V probably benign Het
Srrm4 A G 5: 116,467,508 V230A unknown Het
Ssu2 T A 6: 112,382,351 I103F possibly damaging Het
Strip2 T A 6: 29,931,816 F453I probably damaging Het
Tac2 C T 10: 127,728,450 P72L possibly damaging Het
Tiparp T G 3: 65,552,704 S473R probably damaging Het
Tmem135 C T 7: 89,307,248 R53Q probably damaging Het
Tmem200b T A 4: 131,922,095 F109I probably damaging Het
Tmem245 A T 4: 56,886,141 I825N probably damaging Het
Tmem63c G T 12: 87,056,532 V27F probably damaging Het
Tshz1 T C 18: 84,015,037 I415M probably damaging Het
Wfdc2 T A 2: 164,565,898 N162K probably damaging Het
Zcchc11 C G 4: 108,550,743 A1403G probably damaging Het
Zeb2 T A 2: 44,997,927 I373F probably damaging Het
Zfp27 T C 7: 29,895,379 N387S possibly damaging Het
Zfp760 A T 17: 21,722,375 H177L possibly damaging Het
Zg16 A G 7: 127,050,346 S148P possibly damaging Het
Zic2 A G 14: 122,476,717 N348D probably benign Het
Zswim4 A T 8: 84,212,684 D856E possibly damaging Het
Other mutations in Olfr622
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Olfr622 APN 7 103639832 missense probably damaging 1.00
IGL02972:Olfr622 APN 7 103639894 missense probably damaging 1.00
PIT4434001:Olfr622 UTSW 7 103639847 missense probably damaging 1.00
R1487:Olfr622 UTSW 7 103639594 missense probably damaging 1.00
R1989:Olfr622 UTSW 7 103639495 missense probably damaging 1.00
R3880:Olfr622 UTSW 7 103639624 missense probably benign 0.33
R4595:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R4989:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R5715:Olfr622 UTSW 7 103639802 missense probably damaging 1.00
R5840:Olfr622 UTSW 7 103639256 missense probably benign 0.05
R6046:Olfr622 UTSW 7 103639679 missense probably benign 0.01
R6207:Olfr622 UTSW 7 103640002 missense probably benign 0.29
R6294:Olfr622 UTSW 7 103639591 missense probably damaging 1.00
R6392:Olfr622 UTSW 7 103639682 missense probably benign
R6522:Olfr622 UTSW 7 103639297 missense probably damaging 1.00
R6996:Olfr622 UTSW 7 103639858 missense probably benign 0.10
R7069:Olfr622 UTSW 7 103639960 missense probably damaging 0.99
R7251:Olfr622 UTSW 7 103639702 missense probably damaging 1.00
R7625:Olfr622 UTSW 7 103639958 missense probably damaging 1.00
R8309:Olfr622 UTSW 7 103639451 missense probably damaging 1.00
R8699:Olfr622 UTSW 7 103639615 missense probably damaging 1.00
R8949:Olfr622 UTSW 7 103639495 missense probably damaging 1.00
X0018:Olfr622 UTSW 7 103639598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCACACATCTCATCAGG -3'
(R):5'- CTGGCTTGGAGAATGTTCACTG -3'

Sequencing Primer
(F):5'- TCTCATCAGGCCAACTAGACCTAG -3'
(R):5'- AGAATGTTCACTGTTGGATTGGCATC -3'
Posted On2021-03-08