Incidental Mutation 'R8750:Pwp2'
ID663786
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene NamePWP2 periodic tryptophan protein homolog (yeast)
SynonymsPwp2, Pwp2h, 6530411D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R8750 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location78170909-78185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78177825 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 521 (W521R)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042556]
Predicted Effect probably damaging
Transcript: ENSMUST00000042556
AA Change: W521R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: W521R

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,473 Q172* probably null Het
Ankib1 A G 5: 3,702,890 probably null Het
Avpr1b C T 1: 131,599,936 R66C probably damaging Het
Bbs7 A T 3: 36,607,595 C152S possibly damaging Het
Cacna1a C A 8: 84,559,155 R810S probably damaging Het
Ccdc17 G A 4: 116,599,932 A538T possibly damaging Het
Cd93 T C 2: 148,443,160 M89V probably benign Het
Clec11a G T 7: 44,305,899 D157E probably benign Het
Crtam A C 9: 40,984,345 D228E probably benign Het
Cyp2a4 A G 7: 26,312,784 I331V probably benign Het
Cysltr2 T C 14: 73,029,638 I211V probably benign Het
Dcaf13 T C 15: 39,119,441 S123P probably damaging Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dnah1 A T 14: 31,304,967 L700Q probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dpyd C T 3: 119,141,936 S670L probably damaging Het
Dsg2 A T 18: 20,575,012 I57F possibly damaging Het
Dzip3 A C 16: 48,980,975 I62S probably damaging Het
Ern1 A T 11: 106,421,950 S202T probably damaging Het
Foxm1 T A 6: 128,373,243 C517* probably null Het
Galnt16 G A 12: 80,598,105 V501I probably benign Het
Gmip A T 8: 69,820,484 R840S probably benign Het
Gna14 A C 19: 16,608,094 I279L Het
Irak2 T C 6: 113,686,822 M444T probably benign Het
Itfg2 T C 6: 128,412,792 probably null Het
Kif5a T A 10: 127,248,040 H94L probably damaging Het
Kmt2e A G 5: 23,493,217 T636A probably benign Het
Krba1 T C 6: 48,405,278 S152P probably damaging Het
Mad1l1 T A 5: 140,315,067 M25L probably benign Het
Map7d1 T C 4: 126,238,522 N286D probably benign Het
Mfrp A G 9: 44,103,505 K280E probably benign Het
Mlh3 G T 12: 85,261,714 L1100I probably damaging Het
Mrgprx2 T C 7: 48,482,030 I347V probably benign Het
Mtnr1b A T 9: 15,874,428 C11* probably null Het
Mx1 T C 16: 97,451,717 E401G probably damaging Het
Mypn T C 10: 63,167,257 D367G probably benign Het
Olfr1013 T A 2: 85,769,963 L54H probably damaging Het
Olfr281 T G 15: 98,457,048 I246R probably damaging Het
Olfr622 T A 7: 103,639,852 D96V probably damaging Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Plcb1 T G 2: 135,335,449 M567R probably damaging Het
Plekhd1 A T 12: 80,706,087 D109V probably damaging Het
Polr2e A G 10: 80,039,590 I17T probably benign Het
Pot1b T C 17: 55,666,537 D421G probably benign Het
Prkar1b A T 5: 139,050,696 W224R probably damaging Het
Psmd1 C A 1: 86,088,863 R490S probably damaging Het
Rhpn2 C A 7: 35,376,255 Q286K probably benign Het
Rnf103 T A 6: 71,509,618 M411K probably benign Het
Scpep1 A C 11: 88,944,472 V125G probably damaging Het
Serpinb9c C T 13: 33,151,810 V248M probably null Het
Slc9a3r2 T C 17: 24,642,259 I176V probably damaging Het
Snx15 T A 19: 6,120,563 N282I probably benign Het
Spaca3 A T 11: 80,867,688 D159V probably benign Het
Srrm4 A G 5: 116,467,508 V230A unknown Het
Ssu2 T A 6: 112,382,351 I103F possibly damaging Het
Strip2 T A 6: 29,931,816 F453I probably damaging Het
Tac2 C T 10: 127,728,450 P72L possibly damaging Het
Tiparp T G 3: 65,552,704 S473R probably damaging Het
Tmem135 C T 7: 89,307,248 R53Q probably damaging Het
Tmem200b T A 4: 131,922,095 F109I probably damaging Het
Tmem245 A T 4: 56,886,141 I825N probably damaging Het
Tmem63c G T 12: 87,056,532 V27F probably damaging Het
Tshz1 T C 18: 84,015,037 I415M probably damaging Het
Wfdc2 T A 2: 164,565,898 N162K probably damaging Het
Zcchc11 C G 4: 108,550,743 A1403G probably damaging Het
Zeb2 T A 2: 44,997,927 I373F probably damaging Het
Zfp27 T C 7: 29,895,379 N387S possibly damaging Het
Zfp760 A T 17: 21,722,375 H177L possibly damaging Het
Zg16 A G 7: 127,050,346 S148P possibly damaging Het
Zic2 A G 14: 122,476,717 N348D probably benign Het
Zswim4 A T 8: 84,212,684 D856E possibly damaging Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78179007 missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78178285 missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78184100 missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78181083 missense probably benign
IGL02612:Pwp2 APN 10 78182994 missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78185087 start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78178470 missense probably benign 0.38
R0573:Pwp2 UTSW 10 78182686 missense probably benign 0.37
R1835:Pwp2 UTSW 10 78179091 missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78177742 splice site probably benign
R2251:Pwp2 UTSW 10 78181088 missense probably benign 0.04
R2967:Pwp2 UTSW 10 78182698 missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78182494 missense possibly damaging 0.51
R4950:Pwp2 UTSW 10 78183006 missense probably benign 0.00
R4970:Pwp2 UTSW 10 78173693 missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78182693 missense probably benign 0.23
R5355:Pwp2 UTSW 10 78175544 missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78177771 missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78183001 missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78172118 missense probably benign 0.00
R5928:Pwp2 UTSW 10 78182456 missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78177127 missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78182388 splice site probably null
R6848:Pwp2 UTSW 10 78184293 splice site probably null
R6897:Pwp2 UTSW 10 78172083 missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78173250 splice site probably null
R7269:Pwp2 UTSW 10 78176336 missense probably benign 0.30
R7367:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7368:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78178561 missense probably benign 0.00
R7838:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7898:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78172096 missense possibly damaging 0.82
R8447:Pwp2 UTSW 10 78172039 missense probably benign 0.10
Z1177:Pwp2 UTSW 10 78171974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAACTAGGATCAAGGAGGC -3'
(R):5'- GCACAGAACTCCTTGTAACAAG -3'

Sequencing Primer
(F):5'- CAGCGGCACACTAGAGGAC -3'
(R):5'- CAGTTAATGGAGGGTTCAGCC -3'
Posted On2021-03-08