Incidental Mutation 'R8750:Pot1b'
ID663809
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Nameprotection of telomeres 1B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8750 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55652025-55712628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55666537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 421 (D421G)
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
Predicted Effect probably benign
Transcript: ENSMUST00000086876
AA Change: D421G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: D421G

DomainStartEndE-ValueType
Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,473 Q172* probably null Het
Ankib1 A G 5: 3,702,890 probably null Het
Avpr1b C T 1: 131,599,936 R66C probably damaging Het
Bbs7 A T 3: 36,607,595 C152S possibly damaging Het
Cacna1a C A 8: 84,559,155 R810S probably damaging Het
Ccdc17 G A 4: 116,599,932 A538T possibly damaging Het
Cd93 T C 2: 148,443,160 M89V probably benign Het
Clec11a G T 7: 44,305,899 D157E probably benign Het
Crtam A C 9: 40,984,345 D228E probably benign Het
Cyp2a4 A G 7: 26,312,784 I331V probably benign Het
Cysltr2 T C 14: 73,029,638 I211V probably benign Het
Dcaf13 T C 15: 39,119,441 S123P probably damaging Het
Dctn1 T G 6: 83,183,126 V116G possibly damaging Het
Dmrt3 G A 19: 25,611,186 A130T probably benign Het
Dnah1 A T 14: 31,304,967 L700Q probably benign Het
Dnajc1 T C 2: 18,308,834 T159A probably damaging Het
Dpyd C T 3: 119,141,936 S670L probably damaging Het
Dsg2 A T 18: 20,575,012 I57F possibly damaging Het
Dzip3 A C 16: 48,980,975 I62S probably damaging Het
Ern1 A T 11: 106,421,950 S202T probably damaging Het
Foxm1 T A 6: 128,373,243 C517* probably null Het
Galnt16 G A 12: 80,598,105 V501I probably benign Het
Gmip A T 8: 69,820,484 R840S probably benign Het
Gna14 A C 19: 16,608,094 I279L Het
Irak2 T C 6: 113,686,822 M444T probably benign Het
Itfg2 T C 6: 128,412,792 probably null Het
Kif5a T A 10: 127,248,040 H94L probably damaging Het
Kmt2e A G 5: 23,493,217 T636A probably benign Het
Krba1 T C 6: 48,405,278 S152P probably damaging Het
Mad1l1 T A 5: 140,315,067 M25L probably benign Het
Map7d1 T C 4: 126,238,522 N286D probably benign Het
Mfrp A G 9: 44,103,505 K280E probably benign Het
Mlh3 G T 12: 85,261,714 L1100I probably damaging Het
Mrgprx2 T C 7: 48,482,030 I347V probably benign Het
Mtnr1b A T 9: 15,874,428 C11* probably null Het
Mx1 T C 16: 97,451,717 E401G probably damaging Het
Mypn T C 10: 63,167,257 D367G probably benign Het
Olfr1013 T A 2: 85,769,963 L54H probably damaging Het
Olfr281 T G 15: 98,457,048 I246R probably damaging Het
Olfr622 T A 7: 103,639,852 D96V probably damaging Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Plcb1 T G 2: 135,335,449 M567R probably damaging Het
Plekhd1 A T 12: 80,706,087 D109V probably damaging Het
Polr2e A G 10: 80,039,590 I17T probably benign Het
Prkar1b A T 5: 139,050,696 W224R probably damaging Het
Psmd1 C A 1: 86,088,863 R490S probably damaging Het
Pwp2 A G 10: 78,177,825 W521R probably damaging Het
Rhpn2 C A 7: 35,376,255 Q286K probably benign Het
Rnf103 T A 6: 71,509,618 M411K probably benign Het
Scpep1 A C 11: 88,944,472 V125G probably damaging Het
Serpinb9c C T 13: 33,151,810 V248M probably null Het
Slc9a3r2 T C 17: 24,642,259 I176V probably damaging Het
Snx15 T A 19: 6,120,563 N282I probably benign Het
Spaca3 A T 11: 80,867,688 D159V probably benign Het
Srrm4 A G 5: 116,467,508 V230A unknown Het
Ssu2 T A 6: 112,382,351 I103F possibly damaging Het
Strip2 T A 6: 29,931,816 F453I probably damaging Het
Tac2 C T 10: 127,728,450 P72L possibly damaging Het
Tiparp T G 3: 65,552,704 S473R probably damaging Het
Tmem135 C T 7: 89,307,248 R53Q probably damaging Het
Tmem200b T A 4: 131,922,095 F109I probably damaging Het
Tmem245 A T 4: 56,886,141 I825N probably damaging Het
Tmem63c G T 12: 87,056,532 V27F probably damaging Het
Tshz1 T C 18: 84,015,037 I415M probably damaging Het
Wfdc2 T A 2: 164,565,898 N162K probably damaging Het
Zcchc11 C G 4: 108,550,743 A1403G probably damaging Het
Zeb2 T A 2: 44,997,927 I373F probably damaging Het
Zfp27 T C 7: 29,895,379 N387S possibly damaging Het
Zfp760 A T 17: 21,722,375 H177L possibly damaging Het
Zg16 A G 7: 127,050,346 S148P possibly damaging Het
Zic2 A G 14: 122,476,717 N348D probably benign Het
Zswim4 A T 8: 84,212,684 D856E possibly damaging Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 55695160 missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55669750 missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55662521 missense possibly damaging 0.68
IGL02371:Pot1b APN 17 55695092 missense possibly damaging 0.91
IGL02553:Pot1b APN 17 55695024 splice site probably benign
IGL02957:Pot1b APN 17 55700009 missense probably damaging 0.99
IGL02975:Pot1b APN 17 55662454 splice site probably benign
IGL03172:Pot1b APN 17 55695206 missense possibly damaging 0.60
boulder UTSW 17 55672865 nonsense probably null
erosion UTSW 17 55687834 missense probably damaging 0.99
R0020:Pot1b UTSW 17 55653429 missense probably benign 0.03
R0540:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0607:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0882:Pot1b UTSW 17 55666400 splice site probably benign
R1164:Pot1b UTSW 17 55674085 missense probably benign 0.18
R1476:Pot1b UTSW 17 55653451 missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55654805 missense probably benign
R1955:Pot1b UTSW 17 55674067 missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R1961:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R2109:Pot1b UTSW 17 55653413 missense probably benign 0.00
R2895:Pot1b UTSW 17 55687939 missense probably damaging 0.98
R2943:Pot1b UTSW 17 55674058 missense probably benign
R4681:Pot1b UTSW 17 55654831 missense probably benign 0.28
R4763:Pot1b UTSW 17 55695160 missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55672885 missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55669801 missense probably benign 0.18
R5146:Pot1b UTSW 17 55672865 nonsense probably null
R5176:Pot1b UTSW 17 55699995 missense probably benign 0.05
R5394:Pot1b UTSW 17 55700063 missense probably benign 0.19
R5752:Pot1b UTSW 17 55687834 missense probably damaging 0.99
R6866:Pot1b UTSW 17 55653474 missense possibly damaging 0.83
R8301:Pot1b UTSW 17 55687895 missense probably benign
R8390:Pot1b UTSW 17 55692739 missense probably benign 0.00
RF014:Pot1b UTSW 17 55674106 missense probably benign 0.12
X0062:Pot1b UTSW 17 55695154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACTTCATAAGCAGTAGGTACACG -3'
(R):5'- GTGCTTATGGTATGTATTTACCTACCC -3'

Sequencing Primer
(F):5'- TCACTTGAGTGAGGAAGGA -3'
(R):5'- TATAGGGTGCCCACAAAGTTC -3'
Posted On2021-03-08