Incidental Mutation 'R8751:Exo1'
ID663820
Institutional Source Beutler Lab
Gene Symbol Exo1
Ensembl Gene ENSMUSG00000039748
Gene Nameexonuclease 1
Synonyms5730442G03Rik, Msa
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175880581-175913489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 175892112 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 241 (V241A)
Ref Sequence ENSEMBL: ENSMUSP00000039376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039725] [ENSMUST00000193822] [ENSMUST00000193858] [ENSMUST00000194306] [ENSMUST00000195196]
Predicted Effect probably benign
Transcript: ENSMUST00000039725
AA Change: V241A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039376
Gene: ENSMUSG00000039748
AA Change: V241A

DomainStartEndE-ValueType
XPGN 1 99 6.24e-38 SMART
XPGI 138 208 4.56e-31 SMART
HhH2 212 245 2.28e-8 SMART
Blast:XPGI 252 288 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191680
Predicted Effect probably benign
Transcript: ENSMUST00000193822
SMART Domains Protein: ENSMUSP00000141624
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 83 3.5e-11 SMART
XPGI 98 168 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193858
SMART Domains Protein: ENSMUSP00000141568
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 83 3.5e-11 SMART
XPGI 98 168 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194306
SMART Domains Protein: ENSMUSP00000141770
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 99 2e-40 SMART
XPGI 138 208 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195196
SMART Domains Protein: ENSMUSP00000141870
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 99 2e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced life span, lymphoma development, and male/female sterilty due to defective meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Exo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Exo1 APN 1 175896237 missense probably benign 0.00
IGL01116:Exo1 APN 1 175901397 missense possibly damaging 0.76
IGL01766:Exo1 APN 1 175892021 missense possibly damaging 0.67
IGL02117:Exo1 APN 1 175893743 missense possibly damaging 0.60
IGL02979:Exo1 APN 1 175899407 missense probably damaging 1.00
IGL03026:Exo1 APN 1 175908437 makesense probably null
IGL03109:Exo1 APN 1 175899560 missense probably damaging 1.00
IGL03208:Exo1 APN 1 175896245 missense probably benign 0.01
IGL03342:Exo1 APN 1 175892127 missense probably benign 0.09
IGL03147:Exo1 UTSW 1 175888788 missense probably damaging 1.00
R0194:Exo1 UTSW 1 175892030 missense probably damaging 1.00
R0427:Exo1 UTSW 1 175905953 missense probably damaging 0.96
R0520:Exo1 UTSW 1 175899465 missense probably benign 0.00
R1382:Exo1 UTSW 1 175893796 missense probably damaging 0.98
R1618:Exo1 UTSW 1 175901386 missense probably benign 0.00
R1666:Exo1 UTSW 1 175908486 missense possibly damaging 0.81
R2007:Exo1 UTSW 1 175908530 missense probably damaging 1.00
R2177:Exo1 UTSW 1 175882890 splice site probably null
R2224:Exo1 UTSW 1 175886688 critical splice acceptor site probably null
R2305:Exo1 UTSW 1 175888761 missense probably damaging 1.00
R2509:Exo1 UTSW 1 175905833 missense probably damaging 1.00
R3405:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3406:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3711:Exo1 UTSW 1 175893829 missense probably benign
R3767:Exo1 UTSW 1 175886746 missense probably damaging 1.00
R3787:Exo1 UTSW 1 175899469 missense probably benign
R3853:Exo1 UTSW 1 175892988 missense probably benign 0.01
R5304:Exo1 UTSW 1 175892976 missense probably damaging 1.00
R5625:Exo1 UTSW 1 175893814 missense possibly damaging 0.51
R5869:Exo1 UTSW 1 175901283 missense possibly damaging 0.59
R7013:Exo1 UTSW 1 175893772 missense probably damaging 1.00
R7238:Exo1 UTSW 1 175888847 missense probably damaging 1.00
R7514:Exo1 UTSW 1 175906666 splice site probably null
R7522:Exo1 UTSW 1 175901304 missense probably benign 0.08
R7895:Exo1 UTSW 1 175900996 missense probably benign 0.06
R8218:Exo1 UTSW 1 175900914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGATAAAGGTGCCTTTCCGAG -3'
(R):5'- CTAGGACCCAGGAGTCAAAGTG -3'

Sequencing Primer
(F):5'- GACCATTCTCCTCTGTGTGAAGG -3'
(R):5'- CCAGGAGTCAAAGTGCTCATCTTTAG -3'
Posted On2021-03-08