Incidental Mutation 'R8751:Frem1'
ID 663830
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene Name Fras1 related extracellular matrix protein 1
Synonyms eyes2, heb, eye, crf11, QBRICK
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock # R8751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 82897920-83052339 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82970778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1069 (T1069I)
Ref Sequence ENSEMBL: ENSMUSP00000071627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
AlphaFold Q684R7
Predicted Effect probably damaging
Transcript: ENSMUST00000071708
AA Change: T1069I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: T1069I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: T1050I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: T1050I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127886
SMART Domains Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
Pfam:Cadherin_3 26 158 1.1e-18 PFAM
Pfam:Cadherin_3 150 300 4.6e-36 PFAM
Pfam:Cadherin_3 285 408 6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170248
AA Change: T1051I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: T1051I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
blister UTSW 4 83020770 missense probably benign 0.28
boy UTSW 4 82956255 missense probably benign 0.16
Bubblie UTSW 4 82970633 critical splice donor site probably null
magicbear UTSW 4 83001820 missense probably damaging 1.00
major UTSW 4 82989189 missense probably damaging 1.00
R6324_Frem1_643 UTSW 4 82983337 missense probably benign 0.00
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
R8819:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8820:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8829:Frem1 UTSW 4 83000194 missense probably damaging 1.00
R8834:Frem1 UTSW 4 83004373 missense probably damaging 1.00
R8857:Frem1 UTSW 4 83004043 intron probably benign
R8910:Frem1 UTSW 4 82950457 missense probably benign 0.09
R9036:Frem1 UTSW 4 82913548 missense probably benign
R9228:Frem1 UTSW 4 83001820 missense probably damaging 1.00
R9382:Frem1 UTSW 4 82983385 missense possibly damaging 0.79
R9441:Frem1 UTSW 4 83005846 missense probably damaging 1.00
R9492:Frem1 UTSW 4 83001820 missense probably damaging 1.00
R9517:Frem1 UTSW 4 82983477 missense probably damaging 1.00
R9640:Frem1 UTSW 4 82913659 missense probably benign
R9641:Frem1 UTSW 4 82959416 missense probably damaging 1.00
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGTGGGTCAGGAAACC -3'
(R):5'- AGGAGTTCAGGCTAAGATGC -3'

Sequencing Primer
(F):5'- GAAACCCTGACTTACCTATCCTTATG -3'
(R):5'- GAGCCAATGTGCTCATGTAGATC -3'
Posted On 2021-03-08