Incidental Mutation 'R8751:Emc1'
ID 663831
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 068594-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R8751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 139097279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 724 (H724N)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: H721N

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: H721N

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082262
AA Change: H724N

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: H724N

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: H724N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: H724N

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,813 (GRCm39) I278N probably damaging Het
Adcy9 A G 16: 4,129,492 (GRCm39) W702R probably damaging Het
Adgrf5 G A 17: 43,748,574 (GRCm39) V468I possibly damaging Het
Ahnak A C 19: 8,987,509 (GRCm39) K2931T probably damaging Het
Ank3 C T 10: 69,761,849 (GRCm39) probably benign Het
Birc6 G A 17: 74,955,135 (GRCm39) V3480I probably damaging Het
Bpifa5 A T 2: 154,007,432 (GRCm39) I125L probably benign Het
Catsperg2 T C 7: 29,404,744 (GRCm39) D773G possibly damaging Het
Ccm2l A T 2: 152,909,695 (GRCm39) I16F probably benign Het
Cep72 G A 13: 74,198,303 (GRCm39) S359F possibly damaging Het
Col1a1 A G 11: 94,838,100 (GRCm39) N844S unknown Het
Col7a1 C T 9: 108,796,730 (GRCm39) P1623S possibly damaging Het
Crybg1 T C 10: 43,880,838 (GRCm39) K117E probably benign Het
Csmd3 A G 15: 47,845,402 (GRCm39) C54R Het
Dlg1 A G 16: 31,600,648 (GRCm39) T211A probably benign Het
Epg5 A C 18: 78,008,223 (GRCm39) N784H probably benign Het
Epg5 T A 18: 78,008,225 (GRCm39) N784K probably benign Het
Epg5 A T 18: 78,008,224 (GRCm39) N784I possibly damaging Het
Erc2 A G 14: 27,802,145 (GRCm39) E771G possibly damaging Het
Exo1 T C 1: 175,719,678 (GRCm39) V241A probably benign Het
Fat4 A G 3: 38,946,002 (GRCm39) T1632A probably benign Het
Fbxo21 T A 5: 118,140,127 (GRCm39) M529K probably damaging Het
Fhad1 T C 4: 141,646,134 (GRCm39) E276G probably benign Het
Frem1 G A 4: 82,889,015 (GRCm39) T1069I probably damaging Het
Gapvd1 A C 2: 34,568,078 (GRCm39) F1429V probably damaging Het
Gbp9 T C 5: 105,229,117 (GRCm39) E510G possibly damaging Het
Gm17087 A T 17: 8,785,510 (GRCm39) H64Q probably damaging Het
Gm19965 A T 1: 116,749,867 (GRCm39) Y516F unknown Het
Hdac5 A T 11: 102,109,280 (GRCm39) I38N probably benign Het
Hectd4 T A 5: 121,501,838 (GRCm39) C4190* probably null Het
Helb A T 10: 119,925,412 (GRCm39) D988E probably benign Het
Herc6 C T 6: 57,639,359 (GRCm39) S909L probably damaging Het
Ice1 A T 13: 70,751,010 (GRCm39) V1692E probably damaging Het
Ino80 A G 2: 119,237,389 (GRCm39) Y1107H probably benign Het
Kif9 A T 9: 110,330,724 (GRCm39) Y350F probably benign Het
Lct T A 1: 128,221,534 (GRCm39) T1570S probably benign Het
Lias T A 5: 65,557,193 (GRCm39) N203K probably benign Het
Lrrtm4 A G 6: 79,999,092 (GRCm39) N168S probably damaging Het
Ltf A T 9: 110,860,192 (GRCm39) K538* probably null Het
Lysmd4 A G 7: 66,875,787 (GRCm39) D150G probably benign Het
Magi2 A G 5: 20,739,462 (GRCm39) D572G probably benign Het
Meiob T C 17: 25,047,008 (GRCm39) probably null Het
Ncor2 T C 5: 125,115,964 (GRCm39) Y130C Het
Ntmt2 T A 1: 163,544,738 (GRCm39) T82S probably benign Het
Ofcc1 A G 13: 40,409,072 (GRCm39) S118P probably benign Het
Or10g3 A G 14: 52,610,420 (GRCm39) F30S probably benign Het
Or2t45 A G 11: 58,669,213 (GRCm39) T87A probably benign Het
Or8b55 T A 9: 38,727,335 (GRCm39) C179S probably damaging Het
Parp14 A T 16: 35,677,181 (GRCm39) M929K probably benign Het
Pcdh8 T C 14: 80,006,229 (GRCm39) E778G probably benign Het
Pgls T C 8: 72,047,838 (GRCm39) V211A probably benign Het
Pkd2 T A 5: 104,637,151 (GRCm39) M588K probably damaging Het
Pms1 T C 1: 53,231,269 (GRCm39) N860S probably benign Het
Psg19 C T 7: 18,530,888 (GRCm39) V89M probably benign Het
Reln T C 5: 22,147,672 (GRCm39) H2426R probably benign Het
Ripor2 T A 13: 24,885,050 (GRCm39) N428K possibly damaging Het
Slc12a4 C T 8: 106,676,285 (GRCm39) probably null Het
Slc25a3 T C 10: 90,952,960 (GRCm39) I314V probably benign Het
Slc29a1 C A 17: 45,900,688 (GRCm39) V125F probably benign Het
Slc9a5 T A 8: 106,085,981 (GRCm39) C583S probably damaging Het
Slco2b1 G A 7: 99,309,259 (GRCm39) Q691* probably null Het
Smg7 T C 1: 152,719,129 (GRCm39) D874G probably damaging Het
Spef2 T A 15: 9,729,723 (GRCm39) K132* probably null Het
Tap1 A G 17: 34,412,133 (GRCm39) K446R probably benign Het
Tcam1 A T 11: 106,176,443 (GRCm39) T390S possibly damaging Het
Tnik A G 3: 28,666,057 (GRCm39) N687D probably damaging Het
Trim42 T C 9: 97,251,852 (GRCm39) R16G possibly damaging Het
Vcp A C 4: 42,984,658 (GRCm39) L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 (GRCm39) G91V probably damaging Het
Vmn1r23 T C 6: 57,903,452 (GRCm39) T109A probably benign Het
Vmn2r67 C T 7: 84,801,450 (GRCm39) C162Y probably benign Het
Vmn2r-ps117 A G 17: 19,044,021 (GRCm39) T366A probably benign Het
Zfp804a A G 2: 82,066,190 (GRCm39) K54E probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTACCACACTGCAGGTAGGC -3'
(R):5'- ATAGTACCTCACACATGCCG -3'

Sequencing Primer
(F):5'- TAGGCCAGCTGGAGGATGC -3'
(R):5'- ACATGCCGTGGTACATGC -3'
Posted On 2021-03-08