Incidental Mutation 'R8751:Lias'
ID663835
Institutional Source Beutler Lab
Gene Symbol Lias
Ensembl Gene ENSMUSG00000029199
Gene Namelipoic acid synthetase
SynonymsmLip1, 4933425M12Rik, MGC7254, 2900022L22Rik, 7a5ex
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65391497-65410693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65399850 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 203 (N203K)
Ref Sequence ENSEMBL: ENSMUSP00000113228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031101] [ENSMUST00000122026] [ENSMUST00000200374]
Predicted Effect probably benign
Transcript: ENSMUST00000031101
AA Change: N119K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031101
Gene: ENSMUSG00000029199
AA Change: N119K

DomainStartEndE-ValueType
Pfam:LIAS_N 4 110 5.8e-49 PFAM
Elp3 126 332 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122026
AA Change: N203K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113228
Gene: ENSMUSG00000029199
AA Change: N203K

DomainStartEndE-ValueType
Elp3 42 248 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200374
SMART Domains Protein: ENSMUSP00000143152
Gene: ENSMUSG00000029199

DomainStartEndE-ValueType
Blast:Elp3 2 54 5e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biotin and lipoic acid synthetases family. It localizes in mitochondrion and plays an important role in alpha-(+)-lipoic acid synthesis. It may also function in the sulfur insertion chemistry in lipoate biosynthesis. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before weaning. Embryos homozygous for a null allele become growth arrested and die at E7.5-E9.5. Embryos homozygous for an ENU allele survive to E12.5 showing a growth delay, an open neural tube, microcephaly, dilated hearts and lack of dorsal forebrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Lias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Lias APN 5 65405330 missense probably damaging 1.00
IGL02473:Lias APN 5 65405402 missense possibly damaging 0.95
R6812_Lias_838 UTSW 5 65408789 missense possibly damaging 0.76
R1480:Lias UTSW 5 65392291 missense probably benign
R1677:Lias UTSW 5 65391638 missense probably damaging 1.00
R1836:Lias UTSW 5 65392343 missense probably benign
R4077:Lias UTSW 5 65395425 missense probably benign 0.16
R4438:Lias UTSW 5 65395444 missense probably damaging 1.00
R4458:Lias UTSW 5 65394040 splice site probably null
R4710:Lias UTSW 5 65397727 missense probably benign 0.09
R6050:Lias UTSW 5 65393972 missense possibly damaging 0.47
R6812:Lias UTSW 5 65408789 missense possibly damaging 0.76
R8734:Lias UTSW 5 65404209 missense probably damaging 1.00
X0061:Lias UTSW 5 65392360 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATACACTGCACTCTTCTGAGG -3'
(R):5'- CACTCTTGGCAGCATTCCTG -3'

Sequencing Primer
(F):5'- GGTTTTCATGGAGTGGCTCACC -3'
(R):5'- GGCAGCATTCCTGATTTTCTAC -3'
Posted On2021-03-08