Incidental Mutation 'R8751:Lrrtm4'
ID663843
Institutional Source Beutler Lab
Gene Symbol Lrrtm4
Ensembl Gene ENSMUSG00000052581
Gene Nameleucine rich repeat transmembrane neuronal 4
Synonyms7530419J18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location80018877-80810143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80022109 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 168 (N168S)
Ref Sequence ENSEMBL: ENSMUSP00000117263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074662] [ENSMUST00000126005] [ENSMUST00000126399] [ENSMUST00000128718] [ENSMUST00000133918] [ENSMUST00000136421] [ENSMUST00000145407] [ENSMUST00000147663]
Predicted Effect probably damaging
Transcript: ENSMUST00000074662
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074232
Gene: ENSMUSG00000052581
AA Change: N167S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 4e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126005
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117445
Gene: ENSMUSG00000052581
AA Change: N167S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 4e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126399
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121124
Gene: ENSMUSG00000052581
AA Change: N167S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 2e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128718
Predicted Effect probably damaging
Transcript: ENSMUST00000133918
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115016
Gene: ENSMUSG00000052581
AA Change: N167S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 2e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136421
AA Change: N168S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121621
Gene: ENSMUSG00000052581
AA Change: N168S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 34 66 1.66e0 SMART
LRR_TYP 85 108 6.67e-2 SMART
LRR 109 132 3.52e-1 SMART
LRR_TYP 133 156 2.53e-2 SMART
LRR 157 180 1.16e-1 SMART
LRR 181 204 4.34e-1 SMART
LRR 205 225 2.4e1 SMART
LRR 229 252 4.97e0 SMART
LRR 253 276 1.07e0 SMART
LRR 277 300 1.64e-1 SMART
Blast:LRRCT 312 362 4e-25 BLAST
low complexity region 376 393 N/A INTRINSIC
transmembrane domain 426 448 N/A INTRINSIC
low complexity region 465 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145407
SMART Domains Protein: ENSMUSP00000114465
Gene: ENSMUSG00000052581

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
Blast:LRR_TYP 84 104 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000147663
AA Change: N168S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117263
Gene: ENSMUSG00000052581
AA Change: N168S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 34 66 1.66e0 SMART
LRR_TYP 85 108 6.67e-2 SMART
LRR 109 132 3.52e-1 SMART
LRR_TYP 133 156 2.53e-2 SMART
LRR 157 180 1.16e-1 SMART
LRR 181 204 4.34e-1 SMART
LRR 205 225 2.4e1 SMART
LRR 229 252 4.97e0 SMART
LRR 253 276 1.07e0 SMART
LRR 277 300 1.64e-1 SMART
Blast:LRRCT 312 362 2e-25 BLAST
low complexity region 376 393 N/A INTRINSIC
transmembrane domain 426 448 N/A INTRINSIC
low complexity region 465 470 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired excitatory synapse development and excitatory transmission in dentate gyrus granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Lrrtm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Lrrtm4 APN 6 80022546 missense probably damaging 1.00
IGL02043:Lrrtm4 APN 6 80021862 missense possibly damaging 0.89
IGL02603:Lrrtm4 APN 6 80022984 missense possibly damaging 0.92
IGL02614:Lrrtm4 APN 6 80021844 missense probably benign 0.01
IGL02735:Lrrtm4 APN 6 80809050 missense probably benign
IGL02812:Lrrtm4 APN 6 80021964 missense probably damaging 1.00
IGL02885:Lrrtm4 APN 6 80021803 missense probably damaging 1.00
IGL02956:Lrrtm4 APN 6 80021650 missense probably benign 0.04
IGL03242:Lrrtm4 APN 6 80022088 missense probably benign 0.22
R0504:Lrrtm4 UTSW 6 80022046 missense probably damaging 1.00
R0537:Lrrtm4 UTSW 6 80022120 missense probably benign 0.02
R0656:Lrrtm4 UTSW 6 80021970 missense possibly damaging 0.87
R0698:Lrrtm4 UTSW 6 80022928 missense probably damaging 1.00
R1651:Lrrtm4 UTSW 6 80022528 missense probably benign 0.06
R2126:Lrrtm4 UTSW 6 80021739 missense probably damaging 1.00
R2211:Lrrtm4 UTSW 6 80022640 missense probably benign 0.00
R2363:Lrrtm4 UTSW 6 80021874 missense probably damaging 1.00
R3732:Lrrtm4 UTSW 6 80019655 intron probably benign
R3817:Lrrtm4 UTSW 6 80022061 missense probably benign 0.00
R4814:Lrrtm4 UTSW 6 80023134 missense possibly damaging 0.69
R5304:Lrrtm4 UTSW 6 80022700 missense probably benign 0.01
R5318:Lrrtm4 UTSW 6 80022512 missense probably damaging 1.00
R5327:Lrrtm4 UTSW 6 80022637 missense probably damaging 1.00
R5931:Lrrtm4 UTSW 6 80021739 missense probably damaging 0.99
R6195:Lrrtm4 UTSW 6 80021956 missense probably damaging 1.00
R7597:Lrrtm4 UTSW 6 80022445 nonsense probably null
R7793:Lrrtm4 UTSW 6 80022858 missense probably damaging 0.97
R7875:Lrrtm4 UTSW 6 80022360 missense possibly damaging 0.89
R8058:Lrrtm4 UTSW 6 80022545 missense probably benign
R8238:Lrrtm4 UTSW 6 80022685 missense probably damaging 0.97
R8324:Lrrtm4 UTSW 6 80021991 missense probably damaging 1.00
R8859:Lrrtm4 UTSW 6 80021887 missense probably damaging 1.00
Z1177:Lrrtm4 UTSW 6 80022717 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAAGGGATCCGCAGACTG -3'
(R):5'- CCATTGCAGGTAGATGGATCGC -3'

Sequencing Primer
(F):5'- GATCCGCAGACTGAAAGAATTAATTC -3'
(R):5'- CAGGTAGATGGATCGCAGGTTG -3'
Posted On2021-03-08