Incidental Mutation 'R8751:Olfr922'
ID663852
Institutional Source Beutler Lab
Gene Symbol Olfr922
Ensembl Gene ENSMUSG00000043911
Gene Nameolfactory receptor 922
SynonymsGA_x6K02T2PVTD-32518237-32519172, MOR161-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38814614-38819195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38816039 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 179 (C179S)
Ref Sequence ENSEMBL: ENSMUSP00000149057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051004] [ENSMUST00000213164]
Predicted Effect probably damaging
Transcript: ENSMUST00000051004
AA Change: C179S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057086
Gene: ENSMUSG00000043911
AA Change: C179S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.3e-52 PFAM
Pfam:7tm_1 41 290 3.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213164
AA Change: C179S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Olfr922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr922 APN 9 38816039 missense probably damaging 0.99
IGL02445:Olfr922 APN 9 38815605 missense possibly damaging 0.57
R1758:Olfr922 UTSW 9 38815575 missense probably benign
R1759:Olfr922 UTSW 9 38815898 missense probably damaging 1.00
R1809:Olfr922 UTSW 9 38816147 missense probably benign
R1938:Olfr922 UTSW 9 38815850 missense probably benign 0.33
R2177:Olfr922 UTSW 9 38816186 missense possibly damaging 0.82
R3438:Olfr922 UTSW 9 38816216 missense probably damaging 0.99
R3815:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3816:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3817:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3819:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3859:Olfr922 UTSW 9 38816147 missense probably benign
R4768:Olfr922 UTSW 9 38815949 missense probably damaging 1.00
R5082:Olfr922 UTSW 9 38816145 missense possibly damaging 0.70
R5659:Olfr922 UTSW 9 38815776 missense probably benign 0.01
R5813:Olfr922 UTSW 9 38815656 missense probably benign 0.00
R6226:Olfr922 UTSW 9 38816370 missense probably damaging 0.99
R7240:Olfr922 UTSW 9 38815713 missense probably benign 0.01
R7966:Olfr922 UTSW 9 38816240 missense probably benign 0.11
R8868:Olfr922 UTSW 9 38815989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTTCTTTGTCAGTGCAG -3'
(R):5'- GCCTTAGATCTGCCTTCAGTGG -3'

Sequencing Primer
(F):5'- ACAGTGATGGCATATGATCGCTATG -3'
(R):5'- AGATCTGCCTTCAGTGGATCGG -3'
Posted On2021-03-08