Incidental Mutation 'R8751:Trim42'
ID663853
Institutional Source Beutler Lab
Gene Symbol Trim42
Ensembl Gene ENSMUSG00000032451
Gene Nametripartite motif-containing 42
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location97349562-97369958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97369799 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 16 (R16G)
Ref Sequence ENSEMBL: ENSMUSP00000035026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035026
AA Change: R16G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035026
Gene: ENSMUSG00000032451
AA Change: R16G

DomainStartEndE-ValueType
RING 146 191 3.67e-3 SMART
BBOX 233 280 1.42e0 SMART
BBOX 285 326 1.04e-2 SMART
low complexity region 386 399 N/A INTRINSIC
FN3 603 688 2.44e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Trim42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02289:Trim42 APN 9 97359233 missense probably damaging 0.97
IGL02987:Trim42 APN 9 97365815 missense probably benign 0.28
R0116:Trim42 UTSW 9 97363403 missense possibly damaging 0.89
R0791:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R1170:Trim42 UTSW 9 97363620 missense probably benign 0.04
R1397:Trim42 UTSW 9 97365621 missense probably damaging 1.00
R1499:Trim42 UTSW 9 97366085 missense possibly damaging 0.95
R1522:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R2094:Trim42 UTSW 9 97366097 missense probably benign 0.23
R2355:Trim42 UTSW 9 97359240 missense probably damaging 1.00
R4621:Trim42 UTSW 9 97363148 missense probably benign
R4649:Trim42 UTSW 9 97362945 missense probably benign 0.00
R4840:Trim42 UTSW 9 97362929 missense probably benign 0.02
R6147:Trim42 UTSW 9 97363329 missense probably benign
R7048:Trim42 UTSW 9 97363421 missense probably damaging 1.00
R7235:Trim42 UTSW 9 97369708 missense probably damaging 0.99
R7276:Trim42 UTSW 9 97369572 nonsense probably null
R7390:Trim42 UTSW 9 97359129 missense probably damaging 1.00
R7442:Trim42 UTSW 9 97362945 missense probably damaging 0.97
R7650:Trim42 UTSW 9 97363148 missense probably benign
R7881:Trim42 UTSW 9 97363017 missense possibly damaging 0.83
R8060:Trim42 UTSW 9 97363479 missense probably damaging 1.00
R8427:Trim42 UTSW 9 97363121 missense probably benign 0.25
R8850:Trim42 UTSW 9 97365994 missense probably damaging 1.00
R8856:Trim42 UTSW 9 97363222 nonsense probably null
Z1088:Trim42 UTSW 9 97369622 missense probably benign 0.00
Z1177:Trim42 UTSW 9 97362906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCAGATTGGTGCTGGC -3'
(R):5'- TAAACTGGCCAACTTCCTGCC -3'

Sequencing Primer
(F):5'- GCAGCAGCACTTACAGTTG -3'
(R):5'- GGCCAACTTCCTGCCACAATTC -3'
Posted On2021-03-08