Incidental Mutation 'R8751:Col7a1'
ID663854
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108967662 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1623 (P1623S)
Ref Sequence ENSEMBL: ENSMUSP00000026740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026740
AA Change: P1623S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: P1623S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112070
AA Change: P1623S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: P1623S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
olivetti UTSW 9 108969961 missense probably damaging 1.00
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
R7556:Col7a1 UTSW 9 108982465 splice site probably null
R7571:Col7a1 UTSW 9 108982707 missense probably null
R7815:Col7a1 UTSW 9 108969565 missense probably damaging 0.96
R7875:Col7a1 UTSW 9 108958695 missense unknown
R7931:Col7a1 UTSW 9 108980522 splice site probably benign
R8016:Col7a1 UTSW 9 108958644 missense unknown
R8038:Col7a1 UTSW 9 108957292 missense unknown
R8049:Col7a1 UTSW 9 108975563 missense unknown
R8098:Col7a1 UTSW 9 108956695 missense unknown
R8103:Col7a1 UTSW 9 108975384 missense unknown
R8128:Col7a1 UTSW 9 108955721 missense unknown
R8268:Col7a1 UTSW 9 108972989 missense unknown
R8274:Col7a1 UTSW 9 108969961 missense probably damaging 1.00
R8318:Col7a1 UTSW 9 108958374 missense unknown
R8824:Col7a1 UTSW 9 108967025 missense unknown
RF008:Col7a1 UTSW 9 108964479 missense unknown
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Z1177:Col7a1 UTSW 9 108974923 missense unknown
Z1177:Col7a1 UTSW 9 108976051 missense unknown
Z1177:Col7a1 UTSW 9 108984077 missense unknown
Predicted Primers PCR Primer
(F):5'- AATTCTGACTAGCCTGTTGCCC -3'
(R):5'- GGTCAAAAGCCACAGTTGTG -3'

Sequencing Primer
(F):5'- TCCCATTGGCCTCACTGGAAG -3'
(R):5'- CACAGTTGTGGGGAGGAGTCTC -3'
Posted On2021-03-08