Incidental Mutation 'R8751:Pcdh8'
ID663871
Institutional Source Beutler Lab
Gene Symbol Pcdh8
Ensembl Gene ENSMUSG00000036422
Gene Nameprotocadherin 8
Synonyms1700080P15Rik, Papc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8751 (G1)
Quality Score184.009
Status Not validated
Chromosome14
Chromosomal Location79766775-79771312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79768789 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 778 (E778G)
Ref Sequence ENSEMBL: ENSMUSP00000045333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]
Predicted Effect probably benign
Transcript: ENSMUST00000039568
AA Change: E778G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: E778G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 782 802 N/A INTRINSIC
low complexity region 828 860 N/A INTRINSIC
low complexity region 910 933 N/A INTRINSIC
low complexity region 974 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195355
AA Change: E778G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: E778G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 813 836 N/A INTRINSIC
low complexity region 877 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Pcdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pcdh8 APN 14 79769246 missense probably damaging 0.99
IGL02611:Pcdh8 APN 14 79767667 missense probably benign 0.00
R0094:Pcdh8 UTSW 14 79768148 missense probably damaging 1.00
R0118:Pcdh8 UTSW 14 79767408 missense probably damaging 1.00
R0558:Pcdh8 UTSW 14 79770076 missense probably damaging 1.00
R0681:Pcdh8 UTSW 14 79769960 missense probably benign
R0718:Pcdh8 UTSW 14 79770691 missense possibly damaging 0.49
R1281:Pcdh8 UTSW 14 79767726 missense probably damaging 1.00
R1487:Pcdh8 UTSW 14 79769547 missense probably damaging 1.00
R1511:Pcdh8 UTSW 14 79769389 missense possibly damaging 0.46
R1552:Pcdh8 UTSW 14 79770607 missense probably benign 0.20
R1556:Pcdh8 UTSW 14 79770403 missense probably damaging 1.00
R1659:Pcdh8 UTSW 14 79768134 missense probably damaging 1.00
R2062:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2063:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2068:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2920:Pcdh8 UTSW 14 79768714 missense possibly damaging 0.88
R3970:Pcdh8 UTSW 14 79770266 missense possibly damaging 0.78
R4113:Pcdh8 UTSW 14 79767513 missense probably damaging 1.00
R4771:Pcdh8 UTSW 14 79768270 missense possibly damaging 0.48
R4840:Pcdh8 UTSW 14 79770868 missense possibly damaging 0.67
R5169:Pcdh8 UTSW 14 79767655 missense probably benign 0.09
R5187:Pcdh8 UTSW 14 79770154 missense probably damaging 0.99
R5415:Pcdh8 UTSW 14 79770248 nonsense probably null
R5548:Pcdh8 UTSW 14 79767502 missense probably damaging 1.00
R5749:Pcdh8 UTSW 14 79770085 missense probably damaging 1.00
R5778:Pcdh8 UTSW 14 79770757 missense probably damaging 1.00
R5795:Pcdh8 UTSW 14 79770980 missense possibly damaging 0.95
R6313:Pcdh8 UTSW 14 79767651 missense probably benign 0.02
R7472:Pcdh8 UTSW 14 79771251 splice site probably null
R7540:Pcdh8 UTSW 14 79771103 missense probably benign
R7653:Pcdh8 UTSW 14 79767646 missense probably benign 0.01
R7751:Pcdh8 UTSW 14 79770703 missense probably damaging 0.96
R7836:Pcdh8 UTSW 14 79768661 missense possibly damaging 0.73
R8281:Pcdh8 UTSW 14 79769479 missense probably damaging 0.98
R8365:Pcdh8 UTSW 14 79770986 missense probably damaging 1.00
R8814:Pcdh8 UTSW 14 79768897 missense probably benign 0.00
R8931:Pcdh8 UTSW 14 79769531 nonsense probably null
Z1176:Pcdh8 UTSW 14 79769077 missense probably benign 0.01
Z1177:Pcdh8 UTSW 14 79769881 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCGAAGTGACAGGCGCTTTC -3'
(R):5'- TGCAACCGTCAGTTTCGTG -3'

Sequencing Primer
(F):5'- TGACAGGCGCTTTCCCCAG -3'
(R):5'- AACCGTCAGTTTCGTGGTAACAG -3'
Posted On2021-03-08