Incidental Mutation 'R8751:Adamts12'
ID663873
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R8751 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11215727 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 278 (I278N)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: I278N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: I278N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tap1 A G 17: 34,193,159 K446R probably benign Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- ACAATTGGCTTTCTCACTGTG -3'
(R):5'- TTTGAGACAGAATATCACTCCTCAG -3'

Sequencing Primer
(F):5'- GTTCAGACAGTCTTGATAACTCTGTG -3'
(R):5'- AGTGTAAGCTACCCTCAGACTTTG -3'
Posted On2021-03-08