Incidental Mutation 'R8751:Tap1'
ID 663881
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Name transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms ABC transporter, MHC, 1; ABC17; antigen peptide transporter (APT1); ATP-binding cassette, subfamily B, member 2 (Abcb2); ATP-binding cassette, sub-family B (MDR/TAP), member 2; ATP-binding cassette transporter, major histocompatibility complex, 1; ATP dependent transport protein family member; histocompatibility antigen modifier 1 (Ham-1, Ham1); MTP1; peptide supply factor 1 (PSF-1); peptide transporter PSF1; RING4; transporter 1, ABC; transporter 1, ATP-binding cassette, sub-family B; transporter, ABC, MHC, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter associated with antigen processing 1 (Tap-1, TAP); Y3
MMRRC Submission
Accession Numbers

Genbank: NM_013683; MGI: 98483

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8751 (G1)
Quality Score 195.009
Status Not validated
Chromosome 17
Chromosomal Location 34187553-34197225 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34193159 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 446 (K446R)
Ref Sequence ENSEMBL: ENSMUSP00000128401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000173441]
AlphaFold P21958
Predicted Effect probably benign
Transcript: ENSMUST00000025196
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041633
AA Change: K418R

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: K418R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170086
AA Change: K446R

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: K446R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321
AA Change: K115R

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173441
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,727 I278N probably damaging Het
Adcy9 A G 16: 4,311,628 W702R probably damaging Het
Adgrf5 G A 17: 43,437,683 V468I possibly damaging Het
Ahnak A C 19: 9,010,145 K2931T probably damaging Het
Ank3 C T 10: 69,926,019 probably benign Het
Birc6 G A 17: 74,648,140 V3480I probably damaging Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccm2l A T 2: 153,067,775 I16F probably benign Het
Cep72 G A 13: 74,050,184 S359F possibly damaging Het
Col1a1 A G 11: 94,947,274 N844S unknown Het
Col7a1 C T 9: 108,967,662 P1623S possibly damaging Het
Crybg1 T C 10: 44,004,842 K117E probably benign Het
Csmd3 A G 15: 47,982,006 C54R Het
Dlg1 A G 16: 31,781,830 T211A probably benign Het
Emc1 C A 4: 139,369,968 H724N possibly damaging Het
Epg5 A T 18: 77,965,009 N784I possibly damaging Het
Epg5 A C 18: 77,965,008 N784H probably benign Het
Epg5 T A 18: 77,965,010 N784K probably benign Het
Erc2 A G 14: 28,080,188 E771G possibly damaging Het
Exo1 T C 1: 175,892,112 V241A probably benign Het
Fat4 A G 3: 38,891,853 T1632A probably benign Het
Fbxo21 T A 5: 118,002,062 M529K probably damaging Het
Fhad1 T C 4: 141,918,823 E276G probably benign Het
Frem1 G A 4: 82,970,778 T1069I probably damaging Het
Gapvd1 A C 2: 34,678,066 F1429V probably damaging Het
Gbp9 T C 5: 105,081,251 E510G possibly damaging Het
Gm17087 A T 17: 8,566,678 H64Q probably damaging Het
Gm19965 A T 1: 116,822,137 Y516F unknown Het
Hdac5 A T 11: 102,218,454 I38N probably benign Het
Hectd4 T A 5: 121,363,775 C4190* probably null Het
Helb A T 10: 120,089,507 D988E probably benign Het
Herc6 C T 6: 57,662,374 S909L probably damaging Het
Ice1 A T 13: 70,602,891 V1692E probably damaging Het
Ino80 A G 2: 119,406,908 Y1107H probably benign Het
Kif9 A T 9: 110,501,656 Y350F probably benign Het
Lct T A 1: 128,293,797 T1570S probably benign Het
Lias T A 5: 65,399,850 N203K probably benign Het
Lrrtm4 A G 6: 80,022,109 N168S probably damaging Het
Ltf A T 9: 111,031,124 K538* probably null Het
Lysmd4 A G 7: 67,226,039 D150G probably benign Het
Magi2 A G 5: 20,534,464 D572G probably benign Het
Meiob T C 17: 24,828,034 probably null Het
Mettl11b T A 1: 163,717,169 T82S probably benign Het
Ncor2 T C 5: 125,038,900 Y130C Het
Ofcc1 A G 13: 40,255,596 S118P probably benign Het
Olfr1512 A G 14: 52,372,963 F30S probably benign Het
Olfr315 A G 11: 58,778,387 T87A probably benign Het
Olfr922 T A 9: 38,816,039 C179S probably damaging Het
Parp14 A T 16: 35,856,811 M929K probably benign Het
Pcdh8 T C 14: 79,768,789 E778G probably benign Het
Pgls T C 8: 71,595,194 V211A probably benign Het
Pkd2 T A 5: 104,489,285 M588K probably damaging Het
Pms1 T C 1: 53,192,110 N860S probably benign Het
Psg19 C T 7: 18,796,963 V89M probably benign Het
Reln T C 5: 21,942,674 H2426R probably benign Het
Ripor2 T A 13: 24,701,067 N428K possibly damaging Het
Slc12a4 C T 8: 105,949,653 probably null Het
Slc25a3 T C 10: 91,117,098 I314V probably benign Het
Slc29a1 C A 17: 45,589,762 V125F probably benign Het
Slc9a5 T A 8: 105,359,349 C583S probably damaging Het
Slco2b1 G A 7: 99,660,052 Q691* probably null Het
Smg7 T C 1: 152,843,378 D874G probably damaging Het
Spef2 T A 15: 9,729,637 K132* probably null Het
Tcam1 A T 11: 106,285,617 T390S possibly damaging Het
Tnik A G 3: 28,611,908 N687D probably damaging Het
Trim42 T C 9: 97,369,799 R16G possibly damaging Het
Vcp A C 4: 42,984,658 L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 G91V probably damaging Het
Vmn1r23 T C 6: 57,926,467 T109A probably benign Het
Vmn2r67 C T 7: 85,152,242 C162Y probably benign Het
Vmn2r-ps117 A G 17: 18,823,759 T366A probably benign Het
Zfp804a A G 2: 82,235,846 K54E probably damaging Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34194940 missense probably damaging 1.00
IGL01294:Tap1 APN 17 34194045 critical splice donor site probably null
IGL01776:Tap1 APN 17 34193128 missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34196604 missense probably benign 0.21
IGL02246:Tap1 APN 17 34193989 missense probably benign 0.01
IGL02996:Tap1 APN 17 34191396 missense probably damaging 1.00
IGL03278:Tap1 APN 17 34191483 missense probably damaging 1.00
bullus UTSW 17 34189562 critical splice donor site probably null
entertainer UTSW 17 34193319 splice site probably null
joplin UTSW 17 34193258 missense probably damaging 1.00
ragtime UTSW 17 34190642 nonsense probably null
rose2 UTSW 17 34194941 missense probably damaging 1.00
Tapestry UTSW 17 34193189 missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34193191 missense probably damaging 1.00
R1566:Tap1 UTSW 17 34189546 missense probably benign 0.00
R1795:Tap1 UTSW 17 34194925 missense probably benign 0.21
R1837:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1893:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1952:Tap1 UTSW 17 34193507 missense probably damaging 1.00
R2163:Tap1 UTSW 17 34189473 splice site probably null
R3744:Tap1 UTSW 17 34193612 missense probably damaging 1.00
R3883:Tap1 UTSW 17 34193258 missense probably damaging 1.00
R3975:Tap1 UTSW 17 34189567 unclassified probably benign
R4418:Tap1 UTSW 17 34188379 splice site probably null
R4779:Tap1 UTSW 17 34193891 missense probably damaging 1.00
R4913:Tap1 UTSW 17 34193494 missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34192894 nonsense probably null
R5838:Tap1 UTSW 17 34193305 nonsense probably null
R6248:Tap1 UTSW 17 34193177 missense probably damaging 0.99
R6710:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34188034 missense probably damaging 0.99
R7437:Tap1 UTSW 17 34190642 nonsense probably null
R7514:Tap1 UTSW 17 34196665 missense probably damaging 1.00
R7618:Tap1 UTSW 17 34188238 missense possibly damaging 0.94
R7968:Tap1 UTSW 17 34194912 missense probably damaging 0.99
R8115:Tap1 UTSW 17 34193319 splice site probably null
R8146:Tap1 UTSW 17 34189232 missense probably damaging 0.98
R8322:Tap1 UTSW 17 34193189 missense probably damaging 1.00
R8539:Tap1 UTSW 17 34189435 missense probably benign
R8883:Tap1 UTSW 17 34187893 missense unknown
R8885:Tap1 UTSW 17 34189562 critical splice donor site probably null
R9191:Tap1 UTSW 17 34194982 critical splice donor site probably null
R9232:Tap1 UTSW 17 34193303 missense probably benign 0.00
R9604:Tap1 UTSW 17 34193198 missense probably damaging 0.99
R9656:Tap1 UTSW 17 34193551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGAAGGTGGGAATTC -3'
(R):5'- GTAGACAGTACCTGAAGCACC -3'

Sequencing Primer
(F):5'- AGTTCACCCAGGCTGTTCAG -3'
(R):5'- AGTACCTGAAGCACCTGGACTTTG -3'
Posted On 2021-03-08