Incidental Mutation 'R8751:Epg5'
ID 663886
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules 5 autophagy tethering factor
Synonyms 5430411K18Rik
MMRRC Submission 068594-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R8751 (G1)
Quality Score 89.0077
Status Not validated
Chromosome 18
Chromosomal Location 77981680-78078228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78008224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 784 (N784I)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect possibly damaging
Transcript: ENSMUST00000044622
AA Change: N784I

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: N784I

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 T A 15: 11,215,813 (GRCm39) I278N probably damaging Het
Adcy9 A G 16: 4,129,492 (GRCm39) W702R probably damaging Het
Adgrf5 G A 17: 43,748,574 (GRCm39) V468I possibly damaging Het
Ahnak A C 19: 8,987,509 (GRCm39) K2931T probably damaging Het
Ank3 C T 10: 69,761,849 (GRCm39) probably benign Het
Birc6 G A 17: 74,955,135 (GRCm39) V3480I probably damaging Het
Bpifa5 A T 2: 154,007,432 (GRCm39) I125L probably benign Het
Catsperg2 T C 7: 29,404,744 (GRCm39) D773G possibly damaging Het
Ccm2l A T 2: 152,909,695 (GRCm39) I16F probably benign Het
Cep72 G A 13: 74,198,303 (GRCm39) S359F possibly damaging Het
Col1a1 A G 11: 94,838,100 (GRCm39) N844S unknown Het
Col7a1 C T 9: 108,796,730 (GRCm39) P1623S possibly damaging Het
Crybg1 T C 10: 43,880,838 (GRCm39) K117E probably benign Het
Csmd3 A G 15: 47,845,402 (GRCm39) C54R Het
Dlg1 A G 16: 31,600,648 (GRCm39) T211A probably benign Het
Emc1 C A 4: 139,097,279 (GRCm39) H724N possibly damaging Het
Erc2 A G 14: 27,802,145 (GRCm39) E771G possibly damaging Het
Exo1 T C 1: 175,719,678 (GRCm39) V241A probably benign Het
Fat4 A G 3: 38,946,002 (GRCm39) T1632A probably benign Het
Fbxo21 T A 5: 118,140,127 (GRCm39) M529K probably damaging Het
Fhad1 T C 4: 141,646,134 (GRCm39) E276G probably benign Het
Frem1 G A 4: 82,889,015 (GRCm39) T1069I probably damaging Het
Gapvd1 A C 2: 34,568,078 (GRCm39) F1429V probably damaging Het
Gbp9 T C 5: 105,229,117 (GRCm39) E510G possibly damaging Het
Gm17087 A T 17: 8,785,510 (GRCm39) H64Q probably damaging Het
Gm19965 A T 1: 116,749,867 (GRCm39) Y516F unknown Het
Hdac5 A T 11: 102,109,280 (GRCm39) I38N probably benign Het
Hectd4 T A 5: 121,501,838 (GRCm39) C4190* probably null Het
Helb A T 10: 119,925,412 (GRCm39) D988E probably benign Het
Herc6 C T 6: 57,639,359 (GRCm39) S909L probably damaging Het
Ice1 A T 13: 70,751,010 (GRCm39) V1692E probably damaging Het
Ino80 A G 2: 119,237,389 (GRCm39) Y1107H probably benign Het
Kif9 A T 9: 110,330,724 (GRCm39) Y350F probably benign Het
Lct T A 1: 128,221,534 (GRCm39) T1570S probably benign Het
Lias T A 5: 65,557,193 (GRCm39) N203K probably benign Het
Lrrtm4 A G 6: 79,999,092 (GRCm39) N168S probably damaging Het
Ltf A T 9: 110,860,192 (GRCm39) K538* probably null Het
Lysmd4 A G 7: 66,875,787 (GRCm39) D150G probably benign Het
Magi2 A G 5: 20,739,462 (GRCm39) D572G probably benign Het
Meiob T C 17: 25,047,008 (GRCm39) probably null Het
Ncor2 T C 5: 125,115,964 (GRCm39) Y130C Het
Ntmt2 T A 1: 163,544,738 (GRCm39) T82S probably benign Het
Ofcc1 A G 13: 40,409,072 (GRCm39) S118P probably benign Het
Or10g3 A G 14: 52,610,420 (GRCm39) F30S probably benign Het
Or2t45 A G 11: 58,669,213 (GRCm39) T87A probably benign Het
Or8b55 T A 9: 38,727,335 (GRCm39) C179S probably damaging Het
Parp14 A T 16: 35,677,181 (GRCm39) M929K probably benign Het
Pcdh8 T C 14: 80,006,229 (GRCm39) E778G probably benign Het
Pgls T C 8: 72,047,838 (GRCm39) V211A probably benign Het
Pkd2 T A 5: 104,637,151 (GRCm39) M588K probably damaging Het
Pms1 T C 1: 53,231,269 (GRCm39) N860S probably benign Het
Psg19 C T 7: 18,530,888 (GRCm39) V89M probably benign Het
Reln T C 5: 22,147,672 (GRCm39) H2426R probably benign Het
Ripor2 T A 13: 24,885,050 (GRCm39) N428K possibly damaging Het
Slc12a4 C T 8: 106,676,285 (GRCm39) probably null Het
Slc25a3 T C 10: 90,952,960 (GRCm39) I314V probably benign Het
Slc29a1 C A 17: 45,900,688 (GRCm39) V125F probably benign Het
Slc9a5 T A 8: 106,085,981 (GRCm39) C583S probably damaging Het
Slco2b1 G A 7: 99,309,259 (GRCm39) Q691* probably null Het
Smg7 T C 1: 152,719,129 (GRCm39) D874G probably damaging Het
Spef2 T A 15: 9,729,723 (GRCm39) K132* probably null Het
Tap1 A G 17: 34,412,133 (GRCm39) K446R probably benign Het
Tcam1 A T 11: 106,176,443 (GRCm39) T390S possibly damaging Het
Tnik A G 3: 28,666,057 (GRCm39) N687D probably damaging Het
Trim42 T C 9: 97,251,852 (GRCm39) R16G possibly damaging Het
Vcp A C 4: 42,984,658 (GRCm39) L411W probably damaging Het
Vma21-ps C A 4: 52,496,973 (GRCm39) G91V probably damaging Het
Vmn1r23 T C 6: 57,903,452 (GRCm39) T109A probably benign Het
Vmn2r67 C T 7: 84,801,450 (GRCm39) C162Y probably benign Het
Vmn2r-ps117 A G 17: 19,044,021 (GRCm39) T366A probably benign Het
Zfp804a A G 2: 82,066,190 (GRCm39) K54E probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78,055,956 (GRCm39) missense probably damaging 1.00
IGL01778:Epg5 APN 18 78,062,489 (GRCm39) missense probably damaging 0.98
IGL01936:Epg5 APN 18 78,028,316 (GRCm39) missense probably damaging 1.00
IGL02189:Epg5 APN 18 78,056,085 (GRCm39) missense probably damaging 0.99
IGL02323:Epg5 APN 18 78,056,047 (GRCm39) nonsense probably null
IGL02567:Epg5 APN 18 78,076,288 (GRCm39) missense probably damaging 1.00
IGL02805:Epg5 APN 18 78,073,406 (GRCm39) splice site probably benign
IGL03282:Epg5 APN 18 78,029,641 (GRCm39) missense probably benign 0.25
stitch UTSW 18 77,991,514 (GRCm39) nonsense probably null
R0011:Epg5 UTSW 18 77,991,698 (GRCm39) missense probably benign
R0172:Epg5 UTSW 18 78,070,574 (GRCm39) missense probably benign 0.00
R0335:Epg5 UTSW 18 78,029,687 (GRCm39) missense probably benign 0.25
R0380:Epg5 UTSW 18 78,004,056 (GRCm39) missense probably damaging 1.00
R0441:Epg5 UTSW 18 78,066,486 (GRCm39) splice site probably benign
R0443:Epg5 UTSW 18 77,999,118 (GRCm39) splice site probably benign
R0445:Epg5 UTSW 18 78,057,399 (GRCm39) missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78,066,580 (GRCm39) missense probably damaging 1.00
R0892:Epg5 UTSW 18 78,011,843 (GRCm39) missense possibly damaging 0.94
R1081:Epg5 UTSW 18 78,002,748 (GRCm39) missense possibly damaging 0.92
R1183:Epg5 UTSW 18 78,003,926 (GRCm39) missense probably damaging 1.00
R1374:Epg5 UTSW 18 78,024,541 (GRCm39) missense probably benign
R1428:Epg5 UTSW 18 78,005,642 (GRCm39) missense probably damaging 1.00
R1727:Epg5 UTSW 18 78,059,030 (GRCm39) missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78,067,205 (GRCm39) missense probably damaging 0.99
R1801:Epg5 UTSW 18 78,026,705 (GRCm39) missense possibly damaging 0.63
R1864:Epg5 UTSW 18 78,018,246 (GRCm39) missense probably damaging 0.99
R1908:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1909:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1916:Epg5 UTSW 18 78,008,236 (GRCm39) missense probably benign 0.00
R1986:Epg5 UTSW 18 78,025,521 (GRCm39) critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78,067,202 (GRCm39) missense probably damaging 0.98
R2080:Epg5 UTSW 18 77,991,960 (GRCm39) missense probably benign 0.01
R2106:Epg5 UTSW 18 78,034,578 (GRCm39) nonsense probably null
R2144:Epg5 UTSW 18 77,997,412 (GRCm39) missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78,070,517 (GRCm39) missense probably benign
R2217:Epg5 UTSW 18 77,992,287 (GRCm39) missense probably benign
R2424:Epg5 UTSW 18 78,011,828 (GRCm39) missense probably benign 0.05
R2909:Epg5 UTSW 18 78,026,691 (GRCm39) missense probably damaging 1.00
R3725:Epg5 UTSW 18 78,060,894 (GRCm39) missense probably benign 0.00
R3899:Epg5 UTSW 18 78,000,725 (GRCm39) missense probably damaging 1.00
R4019:Epg5 UTSW 18 78,073,665 (GRCm39) missense probably damaging 0.98
R4260:Epg5 UTSW 18 78,058,914 (GRCm39) missense probably damaging 1.00
R4260:Epg5 UTSW 18 78,002,336 (GRCm39) missense possibly damaging 0.50
R4448:Epg5 UTSW 18 78,005,676 (GRCm39) missense probably damaging 1.00
R4475:Epg5 UTSW 18 77,991,723 (GRCm39) missense probably benign
R4612:Epg5 UTSW 18 78,025,629 (GRCm39) missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78,056,079 (GRCm39) missense probably benign 0.45
R4767:Epg5 UTSW 18 78,066,498 (GRCm39) missense possibly damaging 0.67
R4779:Epg5 UTSW 18 78,034,580 (GRCm39) missense probably benign 0.01
R4791:Epg5 UTSW 18 77,992,211 (GRCm39) nonsense probably null
R4797:Epg5 UTSW 18 78,073,614 (GRCm39) missense probably benign 0.00
R4812:Epg5 UTSW 18 78,022,399 (GRCm39) missense probably benign 0.01
R4899:Epg5 UTSW 18 78,028,272 (GRCm39) missense probably damaging 1.00
R5000:Epg5 UTSW 18 77,997,376 (GRCm39) missense probably benign
R5031:Epg5 UTSW 18 78,072,163 (GRCm39) missense probably benign 0.00
R5050:Epg5 UTSW 18 78,019,156 (GRCm39) missense possibly damaging 0.55
R5114:Epg5 UTSW 18 78,038,828 (GRCm39) missense probably benign
R5144:Epg5 UTSW 18 78,058,895 (GRCm39) missense probably damaging 1.00
R5209:Epg5 UTSW 18 77,994,497 (GRCm39) missense probably damaging 1.00
R5213:Epg5 UTSW 18 78,058,049 (GRCm39) missense probably benign 0.01
R5270:Epg5 UTSW 18 78,026,778 (GRCm39) missense possibly damaging 0.79
R5324:Epg5 UTSW 18 78,005,660 (GRCm39) missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78,070,712 (GRCm39) missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77,994,422 (GRCm39) missense possibly damaging 0.81
R5593:Epg5 UTSW 18 78,000,689 (GRCm39) missense probably damaging 1.00
R5718:Epg5 UTSW 18 78,029,618 (GRCm39) missense probably damaging 1.00
R5773:Epg5 UTSW 18 78,004,040 (GRCm39) missense probably damaging 1.00
R5828:Epg5 UTSW 18 78,064,066 (GRCm39) missense probably damaging 0.99
R5847:Epg5 UTSW 18 78,073,270 (GRCm39) missense probably benign 0.06
R5858:Epg5 UTSW 18 77,991,514 (GRCm39) nonsense probably null
R5914:Epg5 UTSW 18 78,002,847 (GRCm39) critical splice donor site probably null
R6124:Epg5 UTSW 18 78,073,260 (GRCm39) missense probably benign
R6228:Epg5 UTSW 18 77,991,677 (GRCm39) missense possibly damaging 0.90
R6252:Epg5 UTSW 18 78,028,382 (GRCm39) missense probably damaging 1.00
R6269:Epg5 UTSW 18 77,991,585 (GRCm39) missense probably benign
R6312:Epg5 UTSW 18 78,022,426 (GRCm39) missense possibly damaging 0.72
R6320:Epg5 UTSW 18 78,005,613 (GRCm39) missense probably damaging 1.00
R6328:Epg5 UTSW 18 78,072,179 (GRCm39) missense possibly damaging 0.88
R6430:Epg5 UTSW 18 78,019,100 (GRCm39) missense probably damaging 1.00
R6458:Epg5 UTSW 18 77,991,469 (GRCm39) missense probably benign 0.03
R6852:Epg5 UTSW 18 78,056,106 (GRCm39) missense probably damaging 1.00
R6915:Epg5 UTSW 18 78,022,380 (GRCm39) missense probably benign 0.00
R6930:Epg5 UTSW 18 78,057,378 (GRCm39) missense probably damaging 0.99
R6932:Epg5 UTSW 18 77,991,824 (GRCm39) missense probably benign 0.00
R7127:Epg5 UTSW 18 78,072,140 (GRCm39) missense probably damaging 1.00
R7207:Epg5 UTSW 18 77,992,170 (GRCm39) missense probably damaging 1.00
R7225:Epg5 UTSW 18 78,055,917 (GRCm39) missense probably benign 0.45
R7358:Epg5 UTSW 18 78,002,252 (GRCm39) missense possibly damaging 0.78
R7414:Epg5 UTSW 18 78,026,747 (GRCm39) missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78,066,493 (GRCm39) missense probably benign 0.01
R7535:Epg5 UTSW 18 78,076,141 (GRCm39) missense probably benign 0.18
R7586:Epg5 UTSW 18 78,073,275 (GRCm39) missense probably benign
R7651:Epg5 UTSW 18 78,024,615 (GRCm39) nonsense probably null
R7715:Epg5 UTSW 18 78,011,801 (GRCm39) missense probably damaging 1.00
R7753:Epg5 UTSW 18 77,991,560 (GRCm39) missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78,052,929 (GRCm39) critical splice donor site probably null
R8114:Epg5 UTSW 18 78,073,365 (GRCm39) missense probably benign 0.41
R8124:Epg5 UTSW 18 78,008,211 (GRCm39) missense probably benign 0.05
R8307:Epg5 UTSW 18 78,065,894 (GRCm39) missense probably damaging 1.00
R8458:Epg5 UTSW 18 77,991,946 (GRCm39) missense probably benign 0.00
R8751:Epg5 UTSW 18 78,008,225 (GRCm39) missense probably benign 0.28
R8751:Epg5 UTSW 18 78,008,223 (GRCm39) missense probably benign 0.07
R8888:Epg5 UTSW 18 78,056,086 (GRCm39) missense possibly damaging 0.76
R8971:Epg5 UTSW 18 78,022,434 (GRCm39) missense probably damaging 1.00
R9045:Epg5 UTSW 18 77,992,014 (GRCm39) missense probably damaging 1.00
R9291:Epg5 UTSW 18 78,056,065 (GRCm39) nonsense probably null
R9327:Epg5 UTSW 18 77,991,435 (GRCm39) missense probably benign 0.00
R9365:Epg5 UTSW 18 77,997,957 (GRCm39) missense probably damaging 1.00
R9742:Epg5 UTSW 18 78,024,170 (GRCm39) missense probably damaging 1.00
X0023:Epg5 UTSW 18 78,011,872 (GRCm39) missense probably damaging 0.99
X0060:Epg5 UTSW 18 78,005,700 (GRCm39) missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 78,002,354 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCCTTTCTTTGTGATAGTGTAAC -3'
(R):5'- AGATCTCACACTCTGACCTCATAG -3'

Sequencing Primer
(F):5'- GTGTAACCCAGTATACGATCCTG -3'
(R):5'- CACACTCTGACCTCATAGATCTC -3'
Posted On 2021-03-08