Incidental Mutation 'R8752:Dnah7c'
ID 663891
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R8752 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46672541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2643 (I2643V)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: I2643V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: I2643V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,570 K82R probably damaging Het
AA792892 A T 5: 94,381,495 R41S possibly damaging Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Adam29 A T 8: 55,872,293 C375* probably null Het
Adat2 A T 10: 13,556,860 E35D probably benign Het
Afm A C 5: 90,552,565 E600D probably benign Het
Ahnak T A 19: 9,015,537 D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,747,217 probably benign Het
Ankrd28 C A 14: 31,755,742 probably benign Het
Ankrd31 A T 13: 96,780,371 H131L probably damaging Het
Ano5 T C 7: 51,546,869 F183L probably damaging Het
Asah1 G A 8: 41,360,277 S33L possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc47 A G 11: 106,204,992 Y293H probably damaging Het
Cd302 A G 2: 60,272,185 F30S probably damaging Het
Ces1c C G 8: 93,120,336 A243P probably damaging Het
Deptor A T 15: 55,180,884 T149S probably benign Het
Dnah14 G A 1: 181,628,016 R902H probably benign Het
Dnah5 A G 15: 28,290,219 I1252V probably benign Het
Dnajc4 C T 19: 6,989,433 V177I probably benign Het
Efhc1 A T 1: 20,989,468 N581Y probably benign Het
Espl1 A G 15: 102,306,324 T767A probably damaging Het
Etv6 A G 6: 134,266,428 E382G probably benign Het
Foxd4 A T 19: 24,900,730 D35E probably damaging Het
Gata2 T C 6: 88,200,531 V181A possibly damaging Het
Gm5114 A T 7: 39,408,503 M564K probably damaging Het
Gpr45 A T 1: 43,032,682 I162F possibly damaging Het
Hic1 A G 11: 75,169,380 F47S probably benign Het
Hsf1 C A 15: 76,500,144 S417* probably null Het
Id4 A T 13: 48,261,589 H31L possibly damaging Het
Il12rb2 T C 6: 67,351,281 S322G probably damaging Het
Lcn11 T C 2: 25,778,126 Y99H probably damaging Het
Mipol1 G A 12: 57,325,581 R142Q probably damaging Het
Mpp2 A G 11: 102,085,303 S10P probably benign Het
Muc15 A T 2: 110,731,413 N65Y possibly damaging Het
Nav3 T C 10: 109,760,304 probably benign Het
Ndst3 C T 3: 123,549,035 R709Q probably damaging Het
Nek11 G T 9: 105,348,008 Q102K probably benign Het
Nhsl1 A G 10: 18,531,365 N1416D probably benign Het
Olfr1153 T C 2: 87,896,247 I16T possibly damaging Het
Olfr1216 T C 2: 89,013,887 Y59C probably damaging Het
Olfr1341 A C 4: 118,709,886 T160P probably damaging Het
Olfr497 T C 7: 108,423,273 I234T probably benign Het
Olfr56 T A 11: 49,134,678 V162E possibly damaging Het
Parp4 G T 14: 56,648,616 E1717D unknown Het
Pla2g4d A T 2: 120,268,767 probably null Het
Psmc2 A G 5: 21,796,535 I107V probably benign Het
Rhod G T 19: 4,426,093 T210N probably damaging Het
Setx A T 2: 29,158,980 D2006V probably damaging Het
Sfpq T A 4: 127,026,176 M541K possibly damaging Het
Sorbs1 C T 19: 40,361,428 probably null Het
Sv2b C A 7: 75,206,094 M149I possibly damaging Het
Svil T A 18: 5,060,366 probably benign Het
Vmn1r216 G T 13: 23,099,710 V188F probably damaging Het
Vmn2r27 A G 6: 124,224,059 F313S probably benign Het
Vmn2r44 A G 7: 8,367,806 F747S probably damaging Het
Vmn2r95 T C 17: 18,441,476 S495P probably damaging Het
Xpo5 C T 17: 46,236,912 probably benign Het
Zscan20 A C 4: 128,585,687 C1004G probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGCAGGATGTCCCTTGATGAG -3'
(R):5'- AAGTTCAACCCAGGGCACAG -3'

Sequencing Primer
(F):5'- CCCTTGATGAGAGAAATAGATCTGC -3'
(R):5'- ACAGCTCTCACCTGTGCG -3'
Posted On 2021-03-08