Incidental Mutation 'R8752:Olfr1216'
ID663897
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8752 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89013887 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 59 (Y59C)
Ref Sequence ENSEMBL: ENSMUSP00000149441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect probably damaging
Transcript: ENSMUST00000099800
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216000
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217000
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,570 K82R probably damaging Het
AA792892 A T 5: 94,381,495 R41S possibly damaging Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Adam29 A T 8: 55,872,293 C375* probably null Het
Adat2 A T 10: 13,556,860 E35D probably benign Het
Afm A C 5: 90,552,565 E600D probably benign Het
Ahnak T A 19: 9,015,537 D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,747,217 probably benign Het
Ankrd28 C A 14: 31,755,742 probably benign Het
Ankrd31 A T 13: 96,780,371 H131L probably damaging Het
Ano5 T C 7: 51,546,869 F183L probably damaging Het
Asah1 G A 8: 41,360,277 S33L possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc47 A G 11: 106,204,992 Y293H probably damaging Het
Cd302 A G 2: 60,272,185 F30S probably damaging Het
Ces1c C G 8: 93,120,336 A243P probably damaging Het
Deptor A T 15: 55,180,884 T149S probably benign Het
Dnah14 G A 1: 181,628,016 R902H probably benign Het
Dnah5 A G 15: 28,290,219 I1252V probably benign Het
Dnah7c A G 1: 46,672,541 I2643V probably benign Het
Dnajc4 C T 19: 6,989,433 V177I probably benign Het
Efhc1 A T 1: 20,989,468 N581Y probably benign Het
Espl1 A G 15: 102,306,324 T767A probably damaging Het
Etv6 A G 6: 134,266,428 E382G probably benign Het
Foxd4 A T 19: 24,900,730 D35E probably damaging Het
Gata2 T C 6: 88,200,531 V181A possibly damaging Het
Gm5114 A T 7: 39,408,503 M564K probably damaging Het
Gpr45 A T 1: 43,032,682 I162F possibly damaging Het
Hic1 A G 11: 75,169,380 F47S probably benign Het
Hsf1 C A 15: 76,500,144 S417* probably null Het
Id4 A T 13: 48,261,589 H31L possibly damaging Het
Il12rb2 T C 6: 67,351,281 S322G probably damaging Het
Lcn11 T C 2: 25,778,126 Y99H probably damaging Het
Mipol1 G A 12: 57,325,581 R142Q probably damaging Het
Mpp2 A G 11: 102,085,303 S10P probably benign Het
Muc15 A T 2: 110,731,413 N65Y possibly damaging Het
Ndst3 C T 3: 123,549,035 R709Q probably damaging Het
Nek11 G T 9: 105,348,008 Q102K probably benign Het
Nhsl1 A G 10: 18,531,365 N1416D probably benign Het
Olfr1153 T C 2: 87,896,247 I16T possibly damaging Het
Olfr1341 A C 4: 118,709,886 T160P probably damaging Het
Olfr497 T C 7: 108,423,273 I234T probably benign Het
Olfr56 T A 11: 49,134,678 V162E possibly damaging Het
Parp4 G T 14: 56,648,616 E1717D unknown Het
Pla2g4d A T 2: 120,268,767 probably null Het
Psmc2 A G 5: 21,796,535 I107V probably benign Het
Rhod G T 19: 4,426,093 T210N probably damaging Het
Setx A T 2: 29,158,980 D2006V probably damaging Het
Sfpq T A 4: 127,026,176 M541K possibly damaging Het
Sorbs1 C T 19: 40,361,428 probably null Het
Sv2b C A 7: 75,206,094 M149I possibly damaging Het
Vmn1r216 G T 13: 23,099,710 V188F probably damaging Het
Vmn2r27 A G 6: 124,224,059 F313S probably benign Het
Vmn2r44 A G 7: 8,367,806 F747S probably damaging Het
Vmn2r95 T C 17: 18,441,476 S495P probably damaging Het
Xpo5 C T 17: 46,236,912 probably benign Het
Zscan20 A C 4: 128,585,687 C1004G probably damaging Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
R8243:Olfr1216 UTSW 2 89013707 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGGGTTTGCAAATAGCCACG -3'
(R):5'- GCCCTCTTAAGAATTATGCAAAACCAG -3'

Sequencing Primer
(F):5'- TTTGCAAATAGCCACGTAACGGTC -3'
(R):5'- AACCAGAGTTCTGTTACCGAG -3'
Posted On2021-03-08