Incidental Mutation 'R8752:Pla2g4d'
ID663899
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Namephospholipase A2, group IVD
SynonymsPla2delta, 2610311B01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8752 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120265595-120289197 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 120268767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
Predicted Effect probably null
Transcript: ENSMUST00000094665
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,570 K82R probably damaging Het
AA792892 A T 5: 94,381,495 R41S possibly damaging Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Adam29 A T 8: 55,872,293 C375* probably null Het
Adat2 A T 10: 13,556,860 E35D probably benign Het
Afm A C 5: 90,552,565 E600D probably benign Het
Ahnak T A 19: 9,015,537 D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,747,217 probably benign Het
Ankrd28 C A 14: 31,755,742 probably benign Het
Ankrd31 A T 13: 96,780,371 H131L probably damaging Het
Ano5 T C 7: 51,546,869 F183L probably damaging Het
Asah1 G A 8: 41,360,277 S33L possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc47 A G 11: 106,204,992 Y293H probably damaging Het
Cd302 A G 2: 60,272,185 F30S probably damaging Het
Ces1c C G 8: 93,120,336 A243P probably damaging Het
Deptor A T 15: 55,180,884 T149S probably benign Het
Dnah14 G A 1: 181,628,016 R902H probably benign Het
Dnah5 A G 15: 28,290,219 I1252V probably benign Het
Dnah7c A G 1: 46,672,541 I2643V probably benign Het
Dnajc4 C T 19: 6,989,433 V177I probably benign Het
Efhc1 A T 1: 20,989,468 N581Y probably benign Het
Espl1 A G 15: 102,306,324 T767A probably damaging Het
Etv6 A G 6: 134,266,428 E382G probably benign Het
Foxd4 A T 19: 24,900,730 D35E probably damaging Het
Gata2 T C 6: 88,200,531 V181A possibly damaging Het
Gm5114 A T 7: 39,408,503 M564K probably damaging Het
Gpr45 A T 1: 43,032,682 I162F possibly damaging Het
Hic1 A G 11: 75,169,380 F47S probably benign Het
Hsf1 C A 15: 76,500,144 S417* probably null Het
Id4 A T 13: 48,261,589 H31L possibly damaging Het
Il12rb2 T C 6: 67,351,281 S322G probably damaging Het
Lcn11 T C 2: 25,778,126 Y99H probably damaging Het
Mipol1 G A 12: 57,325,581 R142Q probably damaging Het
Mpp2 A G 11: 102,085,303 S10P probably benign Het
Muc15 A T 2: 110,731,413 N65Y possibly damaging Het
Ndst3 C T 3: 123,549,035 R709Q probably damaging Het
Nek11 G T 9: 105,348,008 Q102K probably benign Het
Nhsl1 A G 10: 18,531,365 N1416D probably benign Het
Olfr1153 T C 2: 87,896,247 I16T possibly damaging Het
Olfr1216 T C 2: 89,013,887 Y59C probably damaging Het
Olfr1341 A C 4: 118,709,886 T160P probably damaging Het
Olfr497 T C 7: 108,423,273 I234T probably benign Het
Olfr56 T A 11: 49,134,678 V162E possibly damaging Het
Parp4 G T 14: 56,648,616 E1717D unknown Het
Psmc2 A G 5: 21,796,535 I107V probably benign Het
Rhod G T 19: 4,426,093 T210N probably damaging Het
Setx A T 2: 29,158,980 D2006V probably damaging Het
Sfpq T A 4: 127,026,176 M541K possibly damaging Het
Sorbs1 C T 19: 40,361,428 probably null Het
Sv2b C A 7: 75,206,094 M149I possibly damaging Het
Vmn1r216 G T 13: 23,099,710 V188F probably damaging Het
Vmn2r27 A G 6: 124,224,059 F313S probably benign Het
Vmn2r44 A G 7: 8,367,806 F747S probably damaging Het
Vmn2r95 T C 17: 18,441,476 S495P probably damaging Het
Xpo5 C T 17: 46,236,912 probably benign Het
Zscan20 A C 4: 128,585,687 C1004G probably damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120289164 start gained probably benign
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120277499 missense probably null 1.00
R8737:Pla2g4d UTSW 2 120269985 missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACTATAAAGTTCCAGGATAGC -3'
(R):5'- TAACACAGCTCCTTCTGGGC -3'

Sequencing Primer
(F):5'- TTCCAGGATAGCGACAAGTCCTTG -3'
(R):5'- TAGGGGCTGCAGCAATCTG -3'
Posted On2021-03-08