Mutagenetix > Incidental Mutation

Incidental Mutation 'R8752:Psmc2'

663904

Institutional Source

Beutler Lab

Gene Symbol

Psmc2

Ensembl Gene

ENSMUSG00000028932

Gene Name

proteasome (prosome, macropain) 26S subunit, ATPase 2

Synonyms

MMRRC Submission

068595-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8752 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21990281-22008785 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22001533 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 107 (I107V)

Ref Sequence

ENSEMBL: ENSMUSP00000030769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030769]

AlphaFold

P46471

Predicted Effect

probably benign
Transcript: ENSMUST00000030769
AA Change: I107V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030769
Gene: ENSMUSG00000028932
AA Change: I107V

Domain	Start	End	E-Value	Type
low complexity region	114	125	N/A	INTRINSIC
AAA	250	389	2.74e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit has been shown to interact with several of the basal transcription factors so, in addition to participation in proteasome functions, this subunit may participate in the regulation of transcription. This subunit may also compete with PSMC3 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	T	C	11: 109,704,396 (GRCm39)	K82R	probably damaging	Het
Acad8	A	T	9: 26,896,853 (GRCm39)	M202K	probably damaging	Het
Adam29	A	T	8: 56,325,328 (GRCm39)	C375*	probably null	Het
Adat2	A	T	10: 13,432,604 (GRCm39)	E35D	probably benign	Het
Afm	A	C	5: 90,700,424 (GRCm39)	E600D	probably benign	Het
Ahnak	T	A	19: 8,992,901 (GRCm39)	D4728E	probably damaging	Het
Ak7	AAGGAG	AAG	12: 105,713,476 (GRCm39)		probably benign	Het
Ankrd28	C	A	14: 31,477,699 (GRCm39)		probably benign	Het
Ankrd31	A	T	13: 96,916,879 (GRCm39)	H131L	probably damaging	Het
Ano5	T	C	7: 51,196,617 (GRCm39)	F183L	probably damaging	Het
Asah1	G	A	8: 41,813,314 (GRCm39)	S33L	possibly damaging	Het
Catsperg2	T	C	7: 29,404,744 (GRCm39)	D773G	possibly damaging	Het
Ccdc47	A	G	11: 106,095,818 (GRCm39)	Y293H	probably damaging	Het
Cd302	A	G	2: 60,102,529 (GRCm39)	F30S	probably damaging	Het
Ces1c	C	G	8: 93,846,964 (GRCm39)	A243P	probably damaging	Het
Deptor	A	T	15: 55,044,280 (GRCm39)	T149S	probably benign	Het
Dnah14	G	A	1: 181,455,581 (GRCm39)	R902H	probably benign	Het
Dnah5	A	G	15: 28,290,365 (GRCm39)	I1252V	probably benign	Het
Dnah7c	A	G	1: 46,711,701 (GRCm39)	I2643V	probably benign	Het
Dnajc4	C	T	19: 6,966,801 (GRCm39)	V177I	probably benign	Het
Efhc1	A	T	1: 21,059,692 (GRCm39)	N581Y	probably benign	Het
Espl1	A	G	15: 102,214,759 (GRCm39)	T767A	probably damaging	Het
Etv6	A	G	6: 134,243,391 (GRCm39)	E382G	probably benign	Het
Foxd4	A	T	19: 24,878,094 (GRCm39)	D35E	probably damaging	Het
Gata2	T	C	6: 88,177,513 (GRCm39)	V181A	possibly damaging	Het
Gm5114	A	T	7: 39,057,927 (GRCm39)	M564K	probably damaging	Het
Gpr45	A	T	1: 43,071,842 (GRCm39)	I162F	possibly damaging	Het
Hic1	A	G	11: 75,060,206 (GRCm39)	F47S	probably benign	Het
Hsf1	C	A	15: 76,384,344 (GRCm39)	S417*	probably null	Het
Id4	A	T	13: 48,415,065 (GRCm39)	H31L	possibly damaging	Het
Il12rb2	T	C	6: 67,328,265 (GRCm39)	S322G	probably damaging	Het
Lcn11	T	C	2: 25,668,138 (GRCm39)	Y99H	probably damaging	Het
Mipol1	G	A	12: 57,372,367 (GRCm39)	R142Q	probably damaging	Het
Mpp2	A	G	11: 101,976,129 (GRCm39)	S10P	probably benign	Het
Muc15	A	T	2: 110,561,758 (GRCm39)	N65Y	possibly damaging	Het
Nav3	T	C	10: 109,596,165 (GRCm39)		probably benign	Het
Ndst3	C	T	3: 123,342,684 (GRCm39)	R709Q	probably damaging	Het
Nek11	G	T	9: 105,225,207 (GRCm39)	Q102K	probably benign	Het
Nhsl1	A	G	10: 18,407,113 (GRCm39)	N1416D	probably benign	Het
Or13p3	A	C	4: 118,567,083 (GRCm39)	T160P	probably damaging	Het
Or2v1	T	A	11: 49,025,505 (GRCm39)	V162E	possibly damaging	Het
Or4c111	T	C	2: 88,844,231 (GRCm39)	Y59C	probably damaging	Het
Or5p72	T	C	7: 108,022,480 (GRCm39)	I234T	probably benign	Het
Or5w20	T	C	2: 87,726,591 (GRCm39)	I16T	possibly damaging	Het
Parp4	G	T	14: 56,886,073 (GRCm39)	E1717D	unknown	Het
Pla2g4d	A	T	2: 120,099,248 (GRCm39)		probably null	Het
Pramel52-ps	A	T	5: 94,529,354 (GRCm39)	R41S	possibly damaging	Het
Rhod	G	T	19: 4,476,121 (GRCm39)	T210N	probably damaging	Het
Setx	A	T	2: 29,048,992 (GRCm39)	D2006V	probably damaging	Het
Sfpq	T	A	4: 126,919,969 (GRCm39)	M541K	possibly damaging	Het
Sorbs1	C	T	19: 40,349,872 (GRCm39)		probably null	Het
Sv2b	C	A	7: 74,855,842 (GRCm39)	M149I	possibly damaging	Het
Svil	T	A	18: 5,060,366 (GRCm39)		probably benign	Het
Vmn1r216	G	T	13: 23,283,880 (GRCm39)	V188F	probably damaging	Het
Vmn2r27	A	G	6: 124,201,018 (GRCm39)	F313S	probably benign	Het
Vmn2r44	A	G	7: 8,370,805 (GRCm39)	F747S	probably damaging	Het
Vmn2r95	T	C	17: 18,661,738 (GRCm39)	S495P	probably damaging	Het
Xpo5	C	T	17: 46,547,838 (GRCm39)		probably benign	Het
Zscan20	A	C	4: 128,479,480 (GRCm39)	C1004G	probably damaging	Het

Other mutations in Psmc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Psmc2	APN	5	22,006,196 (GRCm39)	splice site	probably benign
IGL01324:Psmc2	APN	5	22,005,007 (GRCm39)	critical splice donor site	probably null
IGL01354:Psmc2	APN	5	22,000,834 (GRCm39)	missense	possibly damaging	0.51
IGL02604:Psmc2	APN	5	22,000,098 (GRCm39)	splice site	probably null
R1656:Psmc2	UTSW	5	22,004,549 (GRCm39)	missense	possibly damaging	0.77
R2154:Psmc2	UTSW	5	22,008,127 (GRCm39)	missense	possibly damaging	0.94
R4684:Psmc2	UTSW	5	22,008,263 (GRCm39)	missense	possibly damaging	0.94
R5012:Psmc2	UTSW	5	22,007,563 (GRCm39)	missense	probably benign	0.09
R6736:Psmc2	UTSW	5	22,005,574 (GRCm39)	missense	probably damaging	0.99
R6989:Psmc2	UTSW	5	22,006,217 (GRCm39)	missense	possibly damaging	0.91
R7681:Psmc2	UTSW	5	22,008,272 (GRCm39)	critical splice donor site	probably null
R8120:Psmc2	UTSW	5	22,005,566 (GRCm39)	missense	probably damaging	1.00
R8823:Psmc2	UTSW	5	22,005,574 (GRCm39)	missense	probably damaging	0.99
R9798:Psmc2	UTSW	5	22,000,806 (GRCm39)	missense	probably benign	0.01
Z1176:Psmc2	UTSW	5	22,006,315 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCAGAAAGGTAGCACTTG -3'
(R):5'- GCATCTCCACTTTGATATGATCACAAC -3'

Sequencing Primer
(F):5'- ggagttactcactcccaatg -3'
(R):5'- CCACTTTGATATGATCACAACTTCAC -3'

Posted On

2021-03-08