Incidental Mutation 'R8752:Etv6'
ID 663910
Institutional Source Beutler Lab
Gene Symbol Etv6
Ensembl Gene ENSMUSG00000030199
Gene Name ets variant 6
Synonyms translocation-ets-leukemia, Tel
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007961.3; MGI: 109336

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8752 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 134035700-134270158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134266428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 382 (E382G)
Ref Sequence ENSEMBL: ENSMUSP00000107594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081028] [ENSMUST00000111963]
AlphaFold P97360
Predicted Effect probably benign
Transcript: ENSMUST00000081028
AA Change: E471G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000079818
Gene: ENSMUSG00000030199
AA Change: E471G

DomainStartEndE-ValueType
SAM_PNT 39 125 3.49e-41 SMART
ETS 334 420 7.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111963
AA Change: E382G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107594
Gene: ENSMUSG00000030199
AA Change: E382G

DomainStartEndE-ValueType
Pfam:SAM_PNT 1 36 1.3e-10 PFAM
ETS 245 331 7.02e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype Strain: 2177950; 3056143
Lethality: E11-E14
FUNCTION: This gene encodes a transcriptional repressor belonging to the ETS family of proteins. Knockout of this gene in mice results in embryonic lethality due to defective angiogenesis. In humans, this gene is often involved in chromosome rearrangements associated with specific cancers. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective yolk sac angiogenesis, excess apoptosis of mesenchymal and neural cells, and midgestational lethality. [provided by MGI curators]
Allele List at MGI

All alleles(134) : Targeted(7) Gene trapped(127)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,570 K82R probably damaging Het
AA792892 A T 5: 94,381,495 R41S possibly damaging Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Adam29 A T 8: 55,872,293 C375* probably null Het
Adat2 A T 10: 13,556,860 E35D probably benign Het
Afm A C 5: 90,552,565 E600D probably benign Het
Ahnak T A 19: 9,015,537 D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,747,217 probably benign Het
Ankrd28 C A 14: 31,755,742 probably benign Het
Ankrd31 A T 13: 96,780,371 H131L probably damaging Het
Ano5 T C 7: 51,546,869 F183L probably damaging Het
Asah1 G A 8: 41,360,277 S33L possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc47 A G 11: 106,204,992 Y293H probably damaging Het
Cd302 A G 2: 60,272,185 F30S probably damaging Het
Ces1c C G 8: 93,120,336 A243P probably damaging Het
Deptor A T 15: 55,180,884 T149S probably benign Het
Dnah14 G A 1: 181,628,016 R902H probably benign Het
Dnah5 A G 15: 28,290,219 I1252V probably benign Het
Dnah7c A G 1: 46,672,541 I2643V probably benign Het
Dnajc4 C T 19: 6,989,433 V177I probably benign Het
Efhc1 A T 1: 20,989,468 N581Y probably benign Het
Espl1 A G 15: 102,306,324 T767A probably damaging Het
Foxd4 A T 19: 24,900,730 D35E probably damaging Het
Gata2 T C 6: 88,200,531 V181A possibly damaging Het
Gm5114 A T 7: 39,408,503 M564K probably damaging Het
Gpr45 A T 1: 43,032,682 I162F possibly damaging Het
Hic1 A G 11: 75,169,380 F47S probably benign Het
Hsf1 C A 15: 76,500,144 S417* probably null Het
Id4 A T 13: 48,261,589 H31L possibly damaging Het
Il12rb2 T C 6: 67,351,281 S322G probably damaging Het
Lcn11 T C 2: 25,778,126 Y99H probably damaging Het
Mipol1 G A 12: 57,325,581 R142Q probably damaging Het
Mpp2 A G 11: 102,085,303 S10P probably benign Het
Muc15 A T 2: 110,731,413 N65Y possibly damaging Het
Nav3 T C 10: 109,760,304 probably benign Het
Ndst3 C T 3: 123,549,035 R709Q probably damaging Het
Nek11 G T 9: 105,348,008 Q102K probably benign Het
Nhsl1 A G 10: 18,531,365 N1416D probably benign Het
Olfr1153 T C 2: 87,896,247 I16T possibly damaging Het
Olfr1216 T C 2: 89,013,887 Y59C probably damaging Het
Olfr1341 A C 4: 118,709,886 T160P probably damaging Het
Olfr497 T C 7: 108,423,273 I234T probably benign Het
Olfr56 T A 11: 49,134,678 V162E possibly damaging Het
Parp4 G T 14: 56,648,616 E1717D unknown Het
Pla2g4d A T 2: 120,268,767 probably null Het
Psmc2 A G 5: 21,796,535 I107V probably benign Het
Rhod G T 19: 4,426,093 T210N probably damaging Het
Setx A T 2: 29,158,980 D2006V probably damaging Het
Sfpq T A 4: 127,026,176 M541K possibly damaging Het
Sorbs1 C T 19: 40,361,428 probably null Het
Sv2b C A 7: 75,206,094 M149I possibly damaging Het
Svil T A 18: 5,060,366 probably benign Het
Vmn1r216 G T 13: 23,099,710 V188F probably damaging Het
Vmn2r27 A G 6: 124,224,059 F313S probably benign Het
Vmn2r44 A G 7: 8,367,806 F747S probably damaging Het
Vmn2r95 T C 17: 18,441,476 S495P probably damaging Het
Xpo5 C T 17: 46,236,912 probably benign Het
Zscan20 A C 4: 128,585,687 C1004G probably damaging Het
Other mutations in Etv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Etv6 APN 6 134248387 missense probably benign 0.41
IGL02028:Etv6 APN 6 134248733 missense probably benign 0.01
IGL02173:Etv6 APN 6 134248727 missense possibly damaging 0.68
IGL03074:Etv6 APN 6 134222925 missense probably damaging 0.98
R0056:Etv6 UTSW 6 134248534 nonsense probably null
R0295:Etv6 UTSW 6 134266275 missense probably benign 0.31
R2133:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R3763:Etv6 UTSW 6 134263012 splice site probably benign
R4405:Etv6 UTSW 6 134233534 missense probably damaging 1.00
R6901:Etv6 UTSW 6 134266458 missense probably benign 0.10
R8292:Etv6 UTSW 6 134248546 missense probably benign
R8343:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAGTGGAGGGACATCTTTGG -3'
(R):5'- GAAGCGAACGTGACGTGTGA -3'

Sequencing Primer
(F):5'- GACATCTTTGGGGACACAGATTC -3'
(R):5'- AACGTGACGTGTGAGTCTCAG -3'
Posted On 2021-03-08