Incidental Mutation 'R8752:Mipol1'
ID 663929
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8752 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 57325581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 142 (R142Q)
Ref Sequence ENSEMBL: ENSMUSP00000121617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000123498
AA Change: R142Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: R142Q

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000130447
AA Change: R142Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: R142Q

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000145003
AA Change: R142Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: R142Q

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000153137
AA Change: R142Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: R142Q

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,570 K82R probably damaging Het
AA792892 A T 5: 94,381,495 R41S possibly damaging Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Adam29 A T 8: 55,872,293 C375* probably null Het
Adat2 A T 10: 13,556,860 E35D probably benign Het
Afm A C 5: 90,552,565 E600D probably benign Het
Ahnak T A 19: 9,015,537 D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,747,217 probably benign Het
Ankrd28 C A 14: 31,755,742 probably benign Het
Ankrd31 A T 13: 96,780,371 H131L probably damaging Het
Ano5 T C 7: 51,546,869 F183L probably damaging Het
Asah1 G A 8: 41,360,277 S33L possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc47 A G 11: 106,204,992 Y293H probably damaging Het
Cd302 A G 2: 60,272,185 F30S probably damaging Het
Ces1c C G 8: 93,120,336 A243P probably damaging Het
Deptor A T 15: 55,180,884 T149S probably benign Het
Dnah14 G A 1: 181,628,016 R902H probably benign Het
Dnah5 A G 15: 28,290,219 I1252V probably benign Het
Dnah7c A G 1: 46,672,541 I2643V probably benign Het
Dnajc4 C T 19: 6,989,433 V177I probably benign Het
Efhc1 A T 1: 20,989,468 N581Y probably benign Het
Espl1 A G 15: 102,306,324 T767A probably damaging Het
Etv6 A G 6: 134,266,428 E382G probably benign Het
Foxd4 A T 19: 24,900,730 D35E probably damaging Het
Gata2 T C 6: 88,200,531 V181A possibly damaging Het
Gm5114 A T 7: 39,408,503 M564K probably damaging Het
Gpr45 A T 1: 43,032,682 I162F possibly damaging Het
Hic1 A G 11: 75,169,380 F47S probably benign Het
Hsf1 C A 15: 76,500,144 S417* probably null Het
Id4 A T 13: 48,261,589 H31L possibly damaging Het
Il12rb2 T C 6: 67,351,281 S322G probably damaging Het
Lcn11 T C 2: 25,778,126 Y99H probably damaging Het
Mpp2 A G 11: 102,085,303 S10P probably benign Het
Muc15 A T 2: 110,731,413 N65Y possibly damaging Het
Nav3 T C 10: 109,760,304 probably benign Het
Ndst3 C T 3: 123,549,035 R709Q probably damaging Het
Nek11 G T 9: 105,348,008 Q102K probably benign Het
Nhsl1 A G 10: 18,531,365 N1416D probably benign Het
Olfr1153 T C 2: 87,896,247 I16T possibly damaging Het
Olfr1216 T C 2: 89,013,887 Y59C probably damaging Het
Olfr1341 A C 4: 118,709,886 T160P probably damaging Het
Olfr497 T C 7: 108,423,273 I234T probably benign Het
Olfr56 T A 11: 49,134,678 V162E possibly damaging Het
Parp4 G T 14: 56,648,616 E1717D unknown Het
Pla2g4d A T 2: 120,268,767 probably null Het
Psmc2 A G 5: 21,796,535 I107V probably benign Het
Rhod G T 19: 4,426,093 T210N probably damaging Het
Setx A T 2: 29,158,980 D2006V probably damaging Het
Sfpq T A 4: 127,026,176 M541K possibly damaging Het
Sorbs1 C T 19: 40,361,428 probably null Het
Sv2b C A 7: 75,206,094 M149I possibly damaging Het
Svil T A 18: 5,060,366 probably benign Het
Vmn1r216 G T 13: 23,099,710 V188F probably damaging Het
Vmn2r27 A G 6: 124,224,059 F313S probably benign Het
Vmn2r44 A G 7: 8,367,806 F747S probably damaging Het
Vmn2r95 T C 17: 18,441,476 S495P probably damaging Het
Xpo5 C T 17: 46,236,912 probably benign Het
Zscan20 A C 4: 128,585,687 C1004G probably damaging Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTCCACAAGTCACTCATTGA -3'
(R):5'- CACAGTGGCCAGGAGAAGC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GAGACAAATTCAAGCAGATCTCTG -3'
Posted On 2021-03-08