Incidental Mutation 'R8752:Espl1'
ID 663939
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 068595-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8752 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102214759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 767 (T767A)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: T767A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: T767A

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: T767A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5632 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,704,396 (GRCm39) K82R probably damaging Het
Acad8 A T 9: 26,896,853 (GRCm39) M202K probably damaging Het
Adam29 A T 8: 56,325,328 (GRCm39) C375* probably null Het
Adat2 A T 10: 13,432,604 (GRCm39) E35D probably benign Het
Afm A C 5: 90,700,424 (GRCm39) E600D probably benign Het
Ahnak T A 19: 8,992,901 (GRCm39) D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,713,476 (GRCm39) probably benign Het
Ankrd28 C A 14: 31,477,699 (GRCm39) probably benign Het
Ankrd31 A T 13: 96,916,879 (GRCm39) H131L probably damaging Het
Ano5 T C 7: 51,196,617 (GRCm39) F183L probably damaging Het
Asah1 G A 8: 41,813,314 (GRCm39) S33L possibly damaging Het
Catsperg2 T C 7: 29,404,744 (GRCm39) D773G possibly damaging Het
Ccdc47 A G 11: 106,095,818 (GRCm39) Y293H probably damaging Het
Cd302 A G 2: 60,102,529 (GRCm39) F30S probably damaging Het
Ces1c C G 8: 93,846,964 (GRCm39) A243P probably damaging Het
Deptor A T 15: 55,044,280 (GRCm39) T149S probably benign Het
Dnah14 G A 1: 181,455,581 (GRCm39) R902H probably benign Het
Dnah5 A G 15: 28,290,365 (GRCm39) I1252V probably benign Het
Dnah7c A G 1: 46,711,701 (GRCm39) I2643V probably benign Het
Dnajc4 C T 19: 6,966,801 (GRCm39) V177I probably benign Het
Efhc1 A T 1: 21,059,692 (GRCm39) N581Y probably benign Het
Etv6 A G 6: 134,243,391 (GRCm39) E382G probably benign Het
Foxd4 A T 19: 24,878,094 (GRCm39) D35E probably damaging Het
Gata2 T C 6: 88,177,513 (GRCm39) V181A possibly damaging Het
Gm5114 A T 7: 39,057,927 (GRCm39) M564K probably damaging Het
Gpr45 A T 1: 43,071,842 (GRCm39) I162F possibly damaging Het
Hic1 A G 11: 75,060,206 (GRCm39) F47S probably benign Het
Hsf1 C A 15: 76,384,344 (GRCm39) S417* probably null Het
Id4 A T 13: 48,415,065 (GRCm39) H31L possibly damaging Het
Il12rb2 T C 6: 67,328,265 (GRCm39) S322G probably damaging Het
Lcn11 T C 2: 25,668,138 (GRCm39) Y99H probably damaging Het
Mipol1 G A 12: 57,372,367 (GRCm39) R142Q probably damaging Het
Mpp2 A G 11: 101,976,129 (GRCm39) S10P probably benign Het
Muc15 A T 2: 110,561,758 (GRCm39) N65Y possibly damaging Het
Nav3 T C 10: 109,596,165 (GRCm39) probably benign Het
Ndst3 C T 3: 123,342,684 (GRCm39) R709Q probably damaging Het
Nek11 G T 9: 105,225,207 (GRCm39) Q102K probably benign Het
Nhsl1 A G 10: 18,407,113 (GRCm39) N1416D probably benign Het
Or13p3 A C 4: 118,567,083 (GRCm39) T160P probably damaging Het
Or2v1 T A 11: 49,025,505 (GRCm39) V162E possibly damaging Het
Or4c111 T C 2: 88,844,231 (GRCm39) Y59C probably damaging Het
Or5p72 T C 7: 108,022,480 (GRCm39) I234T probably benign Het
Or5w20 T C 2: 87,726,591 (GRCm39) I16T possibly damaging Het
Parp4 G T 14: 56,886,073 (GRCm39) E1717D unknown Het
Pla2g4d A T 2: 120,099,248 (GRCm39) probably null Het
Pramel52-ps A T 5: 94,529,354 (GRCm39) R41S possibly damaging Het
Psmc2 A G 5: 22,001,533 (GRCm39) I107V probably benign Het
Rhod G T 19: 4,476,121 (GRCm39) T210N probably damaging Het
Setx A T 2: 29,048,992 (GRCm39) D2006V probably damaging Het
Sfpq T A 4: 126,919,969 (GRCm39) M541K possibly damaging Het
Sorbs1 C T 19: 40,349,872 (GRCm39) probably null Het
Sv2b C A 7: 74,855,842 (GRCm39) M149I possibly damaging Het
Svil T A 18: 5,060,366 (GRCm39) probably benign Het
Vmn1r216 G T 13: 23,283,880 (GRCm39) V188F probably damaging Het
Vmn2r27 A G 6: 124,201,018 (GRCm39) F313S probably benign Het
Vmn2r44 A G 7: 8,370,805 (GRCm39) F747S probably damaging Het
Vmn2r95 T C 17: 18,661,738 (GRCm39) S495P probably damaging Het
Xpo5 C T 17: 46,547,838 (GRCm39) probably benign Het
Zscan20 A C 4: 128,479,480 (GRCm39) C1004G probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAATGCCACCAGTGTGC -3'
(R):5'- TTAGATAAAACTGCTCACCACCTG -3'

Sequencing Primer
(F):5'- CCACAGGCTGGGTTTGTGC -3'
(R):5'- CCAGGACTTTGCATTATTGGCCAAG -3'
Posted On 2021-03-08