Incidental Mutation 'R8752:Espl1'
ID663939
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8752 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102306324 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 767 (T767A)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: T767A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: T767A

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: T767A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5632 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,570 K82R probably damaging Het
AA792892 A T 5: 94,381,495 R41S possibly damaging Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Adam29 A T 8: 55,872,293 C375* probably null Het
Adat2 A T 10: 13,556,860 E35D probably benign Het
Afm A C 5: 90,552,565 E600D probably benign Het
Ahnak T A 19: 9,015,537 D4728E probably damaging Het
Ak7 AAGGAG AAG 12: 105,747,217 probably benign Het
Ankrd28 C A 14: 31,755,742 probably benign Het
Ankrd31 A T 13: 96,780,371 H131L probably damaging Het
Ano5 T C 7: 51,546,869 F183L probably damaging Het
Asah1 G A 8: 41,360,277 S33L possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc47 A G 11: 106,204,992 Y293H probably damaging Het
Cd302 A G 2: 60,272,185 F30S probably damaging Het
Ces1c C G 8: 93,120,336 A243P probably damaging Het
Deptor A T 15: 55,180,884 T149S probably benign Het
Dnah14 G A 1: 181,628,016 R902H probably benign Het
Dnah5 A G 15: 28,290,219 I1252V probably benign Het
Dnah7c A G 1: 46,672,541 I2643V probably benign Het
Dnajc4 C T 19: 6,989,433 V177I probably benign Het
Efhc1 A T 1: 20,989,468 N581Y probably benign Het
Etv6 A G 6: 134,266,428 E382G probably benign Het
Foxd4 A T 19: 24,900,730 D35E probably damaging Het
Gata2 T C 6: 88,200,531 V181A possibly damaging Het
Gm5114 A T 7: 39,408,503 M564K probably damaging Het
Gpr45 A T 1: 43,032,682 I162F possibly damaging Het
Hic1 A G 11: 75,169,380 F47S probably benign Het
Hsf1 C A 15: 76,500,144 S417* probably null Het
Id4 A T 13: 48,261,589 H31L possibly damaging Het
Il12rb2 T C 6: 67,351,281 S322G probably damaging Het
Lcn11 T C 2: 25,778,126 Y99H probably damaging Het
Mipol1 G A 12: 57,325,581 R142Q probably damaging Het
Mpp2 A G 11: 102,085,303 S10P probably benign Het
Muc15 A T 2: 110,731,413 N65Y possibly damaging Het
Nav3 T C 10: 109,760,304 probably benign Het
Ndst3 C T 3: 123,549,035 R709Q probably damaging Het
Nek11 G T 9: 105,348,008 Q102K probably benign Het
Nhsl1 A G 10: 18,531,365 N1416D probably benign Het
Olfr1153 T C 2: 87,896,247 I16T possibly damaging Het
Olfr1216 T C 2: 89,013,887 Y59C probably damaging Het
Olfr1341 A C 4: 118,709,886 T160P probably damaging Het
Olfr497 T C 7: 108,423,273 I234T probably benign Het
Olfr56 T A 11: 49,134,678 V162E possibly damaging Het
Parp4 G T 14: 56,648,616 E1717D unknown Het
Pla2g4d A T 2: 120,268,767 probably null Het
Psmc2 A G 5: 21,796,535 I107V probably benign Het
Rhod G T 19: 4,426,093 T210N probably damaging Het
Setx A T 2: 29,158,980 D2006V probably damaging Het
Sfpq T A 4: 127,026,176 M541K possibly damaging Het
Sorbs1 C T 19: 40,361,428 probably null Het
Sv2b C A 7: 75,206,094 M149I possibly damaging Het
Svil T A 18: 5,060,366 probably benign Het
Vmn1r216 G T 13: 23,099,710 V188F probably damaging Het
Vmn2r27 A G 6: 124,224,059 F313S probably benign Het
Vmn2r44 A G 7: 8,367,806 F747S probably damaging Het
Vmn2r95 T C 17: 18,441,476 S495P probably damaging Het
Xpo5 C T 17: 46,236,912 probably benign Het
Zscan20 A C 4: 128,585,687 C1004G probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
R8275:Espl1 UTSW 15 102302753 splice site probably benign
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAATGCCACCAGTGTGC -3'
(R):5'- TTAGATAAAACTGCTCACCACCTG -3'

Sequencing Primer
(F):5'- CCACAGGCTGGGTTTGTGC -3'
(R):5'- CCAGGACTTTGCATTATTGGCCAAG -3'
Posted On2021-03-08