Incidental Mutation 'R8753:Rfx8'
ID663948
Institutional Source Beutler Lab
Gene Symbol Rfx8
Ensembl Gene ENSMUSG00000057173
Gene Nameregulatory factor X 8
Synonyms4933400N17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8753 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39665301-39720997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39718440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 56 (V56A)
Ref Sequence ENSEMBL: ENSMUSP00000121212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151913]
Predicted Effect probably damaging
Transcript: ENSMUST00000151913
AA Change: V56A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121212
Gene: ENSMUSG00000057173
AA Change: V56A

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 17 94 6.5e-31 PFAM
Blast:DEXDc 301 358 4e-8 BLAST
low complexity region 445 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,442,694 Y1496H probably damaging Het
Acan G A 7: 79,098,768 E1096K possibly damaging Het
Adprhl1 T C 8: 13,222,118 K1547E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Boc A T 16: 44,500,412 M295K Het
C2cd3 T A 7: 100,399,817 probably null Het
Calcrl C G 2: 84,348,315 G223A probably benign Het
Calcrl C A 2: 84,348,317 M222I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccz1 A G 5: 143,988,232 C469R probably benign Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Clpx G A 9: 65,316,676 G251S probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cpox T A 16: 58,678,028 M408K probably damaging Het
Crybb3 A G 5: 113,078,381 probably null Het
Cubn A T 2: 13,308,566 C3064* probably null Het
Cxcl3 CCTGCTGCTGCTGCTG CCTGCTGCTGCTG 5: 90,786,212 probably benign Het
Cyp4a31 A T 4: 115,574,961 S432C probably benign Het
Ddias A T 7: 92,859,460 F416I probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnttip2 A G 3: 122,280,749 T612A probably damaging Het
Fnip1 A G 11: 54,510,041 T1089A probably damaging Het
Gm12117 A T 11: 33,275,953 L128M probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
H2afy2 T C 10: 61,749,334 D177G possibly damaging Het
Ibtk T C 9: 85,728,766 T285A probably benign Het
Ifi206 A T 1: 173,473,657 N818K unknown Het
Itga10 T G 3: 96,651,155 L305R probably damaging Het
Khnyn T C 14: 55,887,766 Y461H possibly damaging Het
Mbtps1 T C 8: 119,508,862 S1026G possibly damaging Het
Msantd4 A G 9: 4,385,013 E246G probably damaging Het
N4bp1 T C 8: 86,848,457 I737V probably damaging Het
Nav2 T G 7: 49,452,572 S373A probably benign Het
Nbea T C 3: 55,626,908 Y2936C probably damaging Het
Nbeal1 A T 1: 60,268,383 I1685F probably damaging Het
Nt5c3 C G 6: 56,883,692 G293R probably damaging Het
Olfr1315-ps1 A T 2: 112,110,457 V265E probably benign Het
Olfr67 T A 7: 103,787,360 I306F probably benign Het
Pcnx2 A T 8: 125,887,260 V484E probably benign Het
Pcsk5 C T 19: 17,469,044 R1195Q probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pitpnm3 A G 11: 72,051,878 V861A probably benign Het
Pkd1 A G 17: 24,574,202 Y1621C probably damaging Het
Polr3a C A 14: 24,463,634 E846* probably null Het
Polr3e T C 7: 120,940,317 V455A possibly damaging Het
Prr5l C T 2: 101,741,378 G118D probably damaging Het
Pygl G T 12: 70,195,626 N685K probably damaging Het
Sbf1 T C 15: 89,295,459 D1341G probably benign Het
Selenon T C 4: 134,548,019 T123A probably benign Het
Slc23a1 T G 18: 35,619,578 K549Q probably benign Het
Slc7a13 T C 4: 19,841,443 F430S probably damaging Het
Smarcc2 G A 10: 128,483,201 V707M probably damaging Het
St18 A G 1: 6,845,791 S887G probably damaging Het
Tbc1d16 A G 11: 119,210,666 L6P probably damaging Het
Tcf7l2 T C 19: 55,931,763 L576P possibly damaging Het
Tnr A G 1: 159,850,366 D107G probably benign Het
Trpv1 G T 11: 73,244,256 K426N probably damaging Het
Vmn1r15 A T 6: 57,258,910 L254F probably benign Het
Vmn1r219 A T 13: 23,163,021 I127F probably damaging Het
Zc3h14 A T 12: 98,758,572 E164D probably benign Het
Other mutations in Rfx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Rfx8 APN 1 39682950 nonsense probably null
IGL01659:Rfx8 APN 1 39670573 missense probably damaging 1.00
IGL02239:Rfx8 APN 1 39680886 missense probably benign 0.00
IGL02302:Rfx8 APN 1 39665522 missense possibly damaging 0.50
IGL02332:Rfx8 APN 1 39718480 missense possibly damaging 0.89
IGL02598:Rfx8 APN 1 39695968 splice site probably benign
IGL02870:Rfx8 APN 1 39683711 missense possibly damaging 0.94
IGL03403:Rfx8 APN 1 39690173 missense possibly damaging 0.94
PIT4515001:Rfx8 UTSW 1 39690105 missense probably benign 0.04
R0060:Rfx8 UTSW 1 39718405 splice site probably benign
R0095:Rfx8 UTSW 1 39685536 missense possibly damaging 0.58
R0265:Rfx8 UTSW 1 39688577 missense possibly damaging 0.67
R1892:Rfx8 UTSW 1 39670586 splice site probably null
R2054:Rfx8 UTSW 1 39685559 missense possibly damaging 0.92
R2960:Rfx8 UTSW 1 39682952 missense probably damaging 1.00
R4554:Rfx8 UTSW 1 39680940 missense probably benign 0.00
R5410:Rfx8 UTSW 1 39710156 critical splice donor site probably null
R5496:Rfx8 UTSW 1 39670347 missense probably benign 0.01
R5502:Rfx8 UTSW 1 39682953 missense probably damaging 1.00
R5916:Rfx8 UTSW 1 39688619 missense probably benign 0.20
R6238:Rfx8 UTSW 1 39670394 missense probably damaging 0.96
R6360:Rfx8 UTSW 1 39680965 missense probably benign
R7593:Rfx8 UTSW 1 39683678 missense probably damaging 1.00
R7738:Rfx8 UTSW 1 39682931 missense probably damaging 1.00
R8378:Rfx8 UTSW 1 39670421 missense probably damaging 0.98
T0722:Rfx8 UTSW 1 39683612 missense probably damaging 1.00
Z1088:Rfx8 UTSW 1 39682966 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGTCTGTGTTTGGCCAATG -3'
(R):5'- TTGGTTGGACACACCCATGTC -3'

Sequencing Primer
(F):5'- GGCATAAGCTAGCATTACTCAGCATG -3'
(R):5'- TGGACACACCCATGTCTAGTCATG -3'
Posted On2021-03-08