Incidental Mutation 'R8753:Acan'
ID663973
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8753 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79098768 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1096 (E1096K)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032835
AA Change: E1096K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: E1096K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,442,694 Y1496H probably damaging Het
Adprhl1 T C 8: 13,222,118 K1547E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Boc A T 16: 44,500,412 M295K Het
C2cd3 T A 7: 100,399,817 probably null Het
Calcrl C G 2: 84,348,315 G223A probably benign Het
Calcrl C A 2: 84,348,317 M222I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccz1 A G 5: 143,988,232 C469R probably benign Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Clpx G A 9: 65,316,676 G251S probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cpox T A 16: 58,678,028 M408K probably damaging Het
Crybb3 A G 5: 113,078,381 probably null Het
Cubn A T 2: 13,308,566 C3064* probably null Het
Cxcl3 CCTGCTGCTGCTGCTG CCTGCTGCTGCTG 5: 90,786,212 probably benign Het
Cyp4a31 A T 4: 115,574,961 S432C probably benign Het
Ddias A T 7: 92,859,460 F416I probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnttip2 A G 3: 122,280,749 T612A probably damaging Het
Fnip1 A G 11: 54,510,041 T1089A probably damaging Het
Gm12117 A T 11: 33,275,953 L128M probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
H2afy2 T C 10: 61,749,334 D177G possibly damaging Het
Ibtk T C 9: 85,728,766 T285A probably benign Het
Ifi206 A T 1: 173,473,657 N818K unknown Het
Itga10 T G 3: 96,651,155 L305R probably damaging Het
Khnyn T C 14: 55,887,766 Y461H possibly damaging Het
Mbtps1 T C 8: 119,508,862 S1026G possibly damaging Het
Msantd4 A G 9: 4,385,013 E246G probably damaging Het
N4bp1 T C 8: 86,848,457 I737V probably damaging Het
Nav2 T G 7: 49,452,572 S373A probably benign Het
Nbea T C 3: 55,626,908 Y2936C probably damaging Het
Nbeal1 A T 1: 60,268,383 I1685F probably damaging Het
Nt5c3 C G 6: 56,883,692 G293R probably damaging Het
Olfr1315-ps1 A T 2: 112,110,457 V265E probably benign Het
Olfr67 T A 7: 103,787,360 I306F probably benign Het
Pcnx2 A T 8: 125,887,260 V484E probably benign Het
Pcsk5 C T 19: 17,469,044 R1195Q probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pitpnm3 A G 11: 72,051,878 V861A probably benign Het
Pkd1 A G 17: 24,574,202 Y1621C probably damaging Het
Polr3a C A 14: 24,463,634 E846* probably null Het
Polr3e T C 7: 120,940,317 V455A possibly damaging Het
Prr5l C T 2: 101,741,378 G118D probably damaging Het
Pygl G T 12: 70,195,626 N685K probably damaging Het
Rfx8 A G 1: 39,718,440 V56A probably damaging Het
Sbf1 T C 15: 89,295,459 D1341G probably benign Het
Selenon T C 4: 134,548,019 T123A probably benign Het
Slc23a1 T G 18: 35,619,578 K549Q probably benign Het
Slc7a13 T C 4: 19,841,443 F430S probably damaging Het
Smarcc2 G A 10: 128,483,201 V707M probably damaging Het
St18 A G 1: 6,845,791 S887G probably damaging Het
Tbc1d16 A G 11: 119,210,666 L6P probably damaging Het
Tcf7l2 T C 19: 55,931,763 L576P possibly damaging Het
Tnr A G 1: 159,850,366 D107G probably benign Het
Trpv1 G T 11: 73,244,256 K426N probably damaging Het
Vmn1r15 A T 6: 57,258,910 L254F probably benign Het
Vmn1r219 A T 13: 23,163,021 I127F probably damaging Het
Zc3h14 A T 12: 98,758,572 E164D probably benign Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGATGTCACTCAGCTTCCTAC -3'
(R):5'- CCTGAAGCAGATGTCTCTAGAC -3'

Sequencing Primer
(F):5'- GATGTCACTCAGCTTCCTACTGAAAG -3'
(R):5'- GAAGCAGATGTCTCTAGACTATCTC -3'
Posted On2021-03-08