Incidental Mutation 'R8753:Clpx'
ID663984
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Namecaseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8753 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location65294260-65330658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65316676 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 251 (G251S)
Ref Sequence ENSEMBL: ENSMUSP00000015501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]
Predicted Effect probably damaging
Transcript: ENSMUST00000015501
AA Change: G251S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: G251S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113824
AA Change: G237S

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: G237S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147279
AA Change: G65S

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357
AA Change: G65S

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
AAA 100 192 1.89e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,442,694 Y1496H probably damaging Het
Acan G A 7: 79,098,768 E1096K possibly damaging Het
Adprhl1 T C 8: 13,222,118 K1547E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Boc A T 16: 44,500,412 M295K Het
C2cd3 T A 7: 100,399,817 probably null Het
Calcrl C G 2: 84,348,315 G223A probably benign Het
Calcrl C A 2: 84,348,317 M222I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccz1 A G 5: 143,988,232 C469R probably benign Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cpox T A 16: 58,678,028 M408K probably damaging Het
Crybb3 A G 5: 113,078,381 probably null Het
Cubn A T 2: 13,308,566 C3064* probably null Het
Cxcl3 CCTGCTGCTGCTGCTG CCTGCTGCTGCTG 5: 90,786,212 probably benign Het
Cyp4a31 A T 4: 115,574,961 S432C probably benign Het
Ddias A T 7: 92,859,460 F416I probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnttip2 A G 3: 122,280,749 T612A probably damaging Het
Fnip1 A G 11: 54,510,041 T1089A probably damaging Het
Gm12117 A T 11: 33,275,953 L128M probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
H2afy2 T C 10: 61,749,334 D177G possibly damaging Het
Ibtk T C 9: 85,728,766 T285A probably benign Het
Ifi206 A T 1: 173,473,657 N818K unknown Het
Itga10 T G 3: 96,651,155 L305R probably damaging Het
Khnyn T C 14: 55,887,766 Y461H possibly damaging Het
Mbtps1 T C 8: 119,508,862 S1026G possibly damaging Het
Msantd4 A G 9: 4,385,013 E246G probably damaging Het
N4bp1 T C 8: 86,848,457 I737V probably damaging Het
Nav2 T G 7: 49,452,572 S373A probably benign Het
Nbea T C 3: 55,626,908 Y2936C probably damaging Het
Nbeal1 A T 1: 60,268,383 I1685F probably damaging Het
Nt5c3 C G 6: 56,883,692 G293R probably damaging Het
Olfr1315-ps1 A T 2: 112,110,457 V265E probably benign Het
Olfr67 T A 7: 103,787,360 I306F probably benign Het
Pcnx2 A T 8: 125,887,260 V484E probably benign Het
Pcsk5 C T 19: 17,469,044 R1195Q probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pitpnm3 A G 11: 72,051,878 V861A probably benign Het
Pkd1 A G 17: 24,574,202 Y1621C probably damaging Het
Polr3a C A 14: 24,463,634 E846* probably null Het
Polr3e T C 7: 120,940,317 V455A possibly damaging Het
Prr5l C T 2: 101,741,378 G118D probably damaging Het
Pygl G T 12: 70,195,626 N685K probably damaging Het
Rfx8 A G 1: 39,718,440 V56A probably damaging Het
Sbf1 T C 15: 89,295,459 D1341G probably benign Het
Selenon T C 4: 134,548,019 T123A probably benign Het
Slc23a1 T G 18: 35,619,578 K549Q probably benign Het
Slc7a13 T C 4: 19,841,443 F430S probably damaging Het
Smarcc2 G A 10: 128,483,201 V707M probably damaging Het
St18 A G 1: 6,845,791 S887G probably damaging Het
Tbc1d16 A G 11: 119,210,666 L6P probably damaging Het
Tcf7l2 T C 19: 55,931,763 L576P possibly damaging Het
Tnr A G 1: 159,850,366 D107G probably benign Het
Trpv1 G T 11: 73,244,256 K426N probably damaging Het
Vmn1r15 A T 6: 57,258,910 L254F probably benign Het
Vmn1r219 A T 13: 23,163,021 I127F probably damaging Het
Zc3h14 A T 12: 98,758,572 E164D probably benign Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65324270 missense probably damaging 1.00
IGL01394:Clpx APN 9 65310213 missense probably damaging 1.00
IGL01395:Clpx APN 9 65301851 missense probably benign 0.00
IGL01521:Clpx APN 9 65318744 missense probably damaging 1.00
IGL02141:Clpx APN 9 65312118 splice site probably null
IGL02512:Clpx APN 9 65310251 missense probably benign
IGL03008:Clpx APN 9 65322775 missense possibly damaging 0.76
IGL03146:Clpx APN 9 65326830 missense probably benign 0.01
IGL03152:Clpx APN 9 65310176 missense possibly damaging 0.56
IGL03309:Clpx APN 9 65322692 missense probably damaging 1.00
kneehigh UTSW 9 65301879 nonsense probably null
locust UTSW 9 65324301 critical splice donor site probably null
IGL02837:Clpx UTSW 9 65324259 missense probably damaging 1.00
R0167:Clpx UTSW 9 65316737 missense possibly damaging 0.53
R0399:Clpx UTSW 9 65322769 missense probably benign 0.03
R0666:Clpx UTSW 9 65310225 missense probably damaging 1.00
R1386:Clpx UTSW 9 65326888 missense probably null 0.88
R1594:Clpx UTSW 9 65324270 missense probably damaging 0.99
R2038:Clpx UTSW 9 65317493 missense probably damaging 1.00
R4131:Clpx UTSW 9 65316655 missense possibly damaging 0.64
R4715:Clpx UTSW 9 65312114 missense possibly damaging 0.92
R5107:Clpx UTSW 9 65308539 missense possibly damaging 0.93
R5248:Clpx UTSW 9 65320850 missense probably damaging 1.00
R5520:Clpx UTSW 9 65317448 nonsense probably null
R5639:Clpx UTSW 9 65329830 missense probably benign 0.00
R5718:Clpx UTSW 9 65299964 missense probably benign
R6109:Clpx UTSW 9 65299952 missense probably benign 0.02
R6172:Clpx UTSW 9 65301879 nonsense probably null
R6173:Clpx UTSW 9 65301879 nonsense probably null
R6748:Clpx UTSW 9 65310159 missense probably benign 0.00
R7287:Clpx UTSW 9 65300013 nonsense probably null
R7409:Clpx UTSW 9 65324247 missense possibly damaging 0.94
R7806:Clpx UTSW 9 65299931 missense probably benign
R7814:Clpx UTSW 9 65324301 critical splice donor site probably null
R8212:Clpx UTSW 9 65320891 missense possibly damaging 0.46
X0067:Clpx UTSW 9 65316695 missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65299997 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACTGATGTAACTATGGACGAGAG -3'
(R):5'- GCCAGAATCCACTATTATTACAAGG -3'

Sequencing Primer
(F):5'- ACGAGAGTTCTCTTCTAGTTCCG -3'
(R):5'- TTTACCTGACCCAGTTGG -3'
Posted On2021-03-08