Mutagenetix > Incidental Mutations

Incidental Mutation 'R8753:Clpx'

663984

Institutional Source

Beutler Lab

Gene Symbol

Clpx

Ensembl Gene

ENSMUSG00000015357

Gene Name

caseinolytic mitochondrial matrix peptidase chaperone subunit

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8753 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65294260-65330658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65316676 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 251 (G251S)

Ref Sequence

ENSEMBL: ENSMUSP00000015501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015501
AA Change: G251S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: G251S

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
PDB:4I9K\|B	173	209	6e-7	PDB
low complexity region	259	268	N/A	INTRINSIC
AAA	286	437	1.64e-12	SMART
low complexity region	452	458	N/A	INTRINSIC
ClpB_D2-small	510	604	1.16e-29	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113824
AA Change: G237S

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: G237S

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
low complexity region	245	254	N/A	INTRINSIC
AAA	272	423	1.64e-12	SMART
low complexity region	438	444	N/A	INTRINSIC
ClpB_D2-small	496	590	1.16e-29	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147279
AA Change: G65S

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357
AA Change: G65S

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
AAA	100	192	1.89e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	C	2: 25,442,694	Y1496H	probably damaging	Het
Acan	G	A	7: 79,098,768	E1096K	possibly damaging	Het
Adprhl1	T	C	8: 13,222,118	K1547E	possibly damaging	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Boc	A	T	16: 44,500,412	M295K		Het
C2cd3	T	A	7: 100,399,817		probably null	Het
Calcrl	C	G	2: 84,348,315	G223A	probably benign	Het
Calcrl	C	A	2: 84,348,317	M222I	probably benign	Het
Ccdc88b	T	C	19: 6,855,845	E278G	probably damaging	Het
Ccz1	A	G	5: 143,988,232	C469R	probably benign	Het
Cdc40	C	T	10: 40,841,484	D404N	probably damaging	Het
Col6a3	C	G	1: 90,767,606		probably benign	Het
Cpox	T	A	16: 58,678,028	M408K	probably damaging	Het
Crybb3	A	G	5: 113,078,381		probably null	Het
Cubn	A	T	2: 13,308,566	C3064*	probably null	Het
Cxcl3	CCTGCTGCTGCTGCTG	CCTGCTGCTGCTG	5: 90,786,212		probably benign	Het
Cyp4a31	A	T	4: 115,574,961	S432C	probably benign	Het
Ddias	A	T	7: 92,859,460	F416I	probably damaging	Het
Dlat	G	T	9: 50,649,667	A360E	probably damaging	Het
Dnttip2	A	G	3: 122,280,749	T612A	probably damaging	Het
Fnip1	A	G	11: 54,510,041	T1089A	probably damaging	Het
Gm12117	A	T	11: 33,275,953	L128M	probably benign	Het
Gtf2h5	C	CA	17: 6,084,558		probably null	Het
H2afy2	T	C	10: 61,749,334	D177G	possibly damaging	Het
Ibtk	T	C	9: 85,728,766	T285A	probably benign	Het
Ifi206	A	T	1: 173,473,657	N818K	unknown	Het
Itga10	T	G	3: 96,651,155	L305R	probably damaging	Het
Khnyn	T	C	14: 55,887,766	Y461H	possibly damaging	Het
Mbtps1	T	C	8: 119,508,862	S1026G	possibly damaging	Het
Msantd4	A	G	9: 4,385,013	E246G	probably damaging	Het
N4bp1	T	C	8: 86,848,457	I737V	probably damaging	Het
Nav2	T	G	7: 49,452,572	S373A	probably benign	Het
Nbea	T	C	3: 55,626,908	Y2936C	probably damaging	Het
Nbeal1	A	T	1: 60,268,383	I1685F	probably damaging	Het
Nt5c3	C	G	6: 56,883,692	G293R	probably damaging	Het
Olfr1315-ps1	A	T	2: 112,110,457	V265E	probably benign	Het
Olfr67	T	A	7: 103,787,360	I306F	probably benign	Het
Pcnx2	A	T	8: 125,887,260	V484E	probably benign	Het
Pcsk5	C	T	19: 17,469,044	R1195Q	probably benign	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Pitpnm3	A	G	11: 72,051,878	V861A	probably benign	Het
Pkd1	A	G	17: 24,574,202	Y1621C	probably damaging	Het
Polr3a	C	A	14: 24,463,634	E846*	probably null	Het
Polr3e	T	C	7: 120,940,317	V455A	possibly damaging	Het
Prr5l	C	T	2: 101,741,378	G118D	probably damaging	Het
Pygl	G	T	12: 70,195,626	N685K	probably damaging	Het
Rfx8	A	G	1: 39,718,440	V56A	probably damaging	Het
Sbf1	T	C	15: 89,295,459	D1341G	probably benign	Het
Selenon	T	C	4: 134,548,019	T123A	probably benign	Het
Slc23a1	T	G	18: 35,619,578	K549Q	probably benign	Het
Slc7a13	T	C	4: 19,841,443	F430S	probably damaging	Het
Smarcc2	G	A	10: 128,483,201	V707M	probably damaging	Het
St18	A	G	1: 6,845,791	S887G	probably damaging	Het
Tbc1d16	A	G	11: 119,210,666	L6P	probably damaging	Het
Tcf7l2	T	C	19: 55,931,763	L576P	possibly damaging	Het
Tnr	A	G	1: 159,850,366	D107G	probably benign	Het
Trpv1	G	T	11: 73,244,256	K426N	probably damaging	Het
Vmn1r15	A	T	6: 57,258,910	L254F	probably benign	Het
Vmn1r219	A	T	13: 23,163,021	I127F	probably damaging	Het
Zc3h14	A	T	12: 98,758,572	E164D	probably benign	Het

Other mutations in Clpx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Clpx	APN	9	65324270	missense	probably damaging	1.00
IGL01394:Clpx	APN	9	65310213	missense	probably damaging	1.00
IGL01395:Clpx	APN	9	65301851	missense	probably benign	0.00
IGL01521:Clpx	APN	9	65318744	missense	probably damaging	1.00
IGL02141:Clpx	APN	9	65312118	splice site	probably null
IGL02512:Clpx	APN	9	65310251	missense	probably benign
IGL03008:Clpx	APN	9	65322775	missense	possibly damaging	0.76
IGL03146:Clpx	APN	9	65326830	missense	probably benign	0.01
IGL03152:Clpx	APN	9	65310176	missense	possibly damaging	0.56
IGL03309:Clpx	APN	9	65322692	missense	probably damaging	1.00
kneehigh	UTSW	9	65301879	nonsense	probably null
locust	UTSW	9	65324301	critical splice donor site	probably null
IGL02837:Clpx	UTSW	9	65324259	missense	probably damaging	1.00
R0167:Clpx	UTSW	9	65316737	missense	possibly damaging	0.53
R0399:Clpx	UTSW	9	65322769	missense	probably benign	0.03
R0666:Clpx	UTSW	9	65310225	missense	probably damaging	1.00
R1386:Clpx	UTSW	9	65326888	missense	probably null	0.88
R1594:Clpx	UTSW	9	65324270	missense	probably damaging	0.99
R2038:Clpx	UTSW	9	65317493	missense	probably damaging	1.00
R4131:Clpx	UTSW	9	65316655	missense	possibly damaging	0.64
R4715:Clpx	UTSW	9	65312114	missense	possibly damaging	0.92
R5107:Clpx	UTSW	9	65308539	missense	possibly damaging	0.93
R5248:Clpx	UTSW	9	65320850	missense	probably damaging	1.00
R5520:Clpx	UTSW	9	65317448	nonsense	probably null
R5639:Clpx	UTSW	9	65329830	missense	probably benign	0.00
R5718:Clpx	UTSW	9	65299964	missense	probably benign
R6109:Clpx	UTSW	9	65299952	missense	probably benign	0.02
R6172:Clpx	UTSW	9	65301879	nonsense	probably null
R6173:Clpx	UTSW	9	65301879	nonsense	probably null
R6748:Clpx	UTSW	9	65310159	missense	probably benign	0.00
R7287:Clpx	UTSW	9	65300013	nonsense	probably null
R7409:Clpx	UTSW	9	65324247	missense	possibly damaging	0.94
R7806:Clpx	UTSW	9	65299931	missense	probably benign
R7814:Clpx	UTSW	9	65324301	critical splice donor site	probably null
R8212:Clpx	UTSW	9	65320891	missense	possibly damaging	0.46
X0067:Clpx	UTSW	9	65316695	missense	possibly damaging	0.86
Z1177:Clpx	UTSW	9	65299997	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACACTGATGTAACTATGGACGAGAG -3'
(R):5'- GCCAGAATCCACTATTATTACAAGG -3'

Sequencing Primer
(F):5'- ACGAGAGTTCTCTTCTAGTTCCG -3'
(R):5'- TTTACCTGACCCAGTTGG -3'

Posted On

2021-03-08