Incidental Mutation 'R8753:Polr3a'
ID 663997
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC1, 9330175N20Rik, RPC155
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8753 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 24448696-24487058 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 24463634 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 846 (E846*)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably null
Transcript: ENSMUST00000026322
AA Change: E846*
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: E846*

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,442,694 Y1496H probably damaging Het
Acan G A 7: 79,098,768 E1096K possibly damaging Het
Adprhl1 T C 8: 13,222,118 K1547E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arf4 T A 14: 26,652,959 probably benign Het
Boc A T 16: 44,500,412 M295K Het
C2cd3 T A 7: 100,399,817 probably null Het
Calcrl C G 2: 84,348,315 G223A probably benign Het
Calcrl C A 2: 84,348,317 M222I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Ccz1 A G 5: 143,988,232 C469R probably benign Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Clpx G A 9: 65,316,676 G251S probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cpox T A 16: 58,678,028 M408K probably damaging Het
Crybb3 A G 5: 113,078,381 probably null Het
Cubn A T 2: 13,308,566 C3064* probably null Het
Cxcl3 CCTGCTGCTGCTGCTG CCTGCTGCTGCTG 5: 90,786,212 probably benign Het
Cyp4a31 A T 4: 115,574,961 S432C probably benign Het
Ddias A T 7: 92,859,460 F416I probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnttip2 A G 3: 122,280,749 T612A probably damaging Het
Fnip1 A G 11: 54,510,041 T1089A probably damaging Het
Gm12117 A T 11: 33,275,953 L128M probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
H2afy2 T C 10: 61,749,334 D177G possibly damaging Het
Ibtk T C 9: 85,728,766 T285A probably benign Het
Ifi206 A T 1: 173,473,657 N818K unknown Het
Itga10 T G 3: 96,651,155 L305R probably damaging Het
Khnyn T C 14: 55,887,766 Y461H possibly damaging Het
Mbtps1 T C 8: 119,508,862 S1026G possibly damaging Het
Msantd4 A G 9: 4,385,013 E246G probably damaging Het
N4bp1 T C 8: 86,848,457 I737V probably damaging Het
Nav2 T G 7: 49,452,572 S373A probably benign Het
Nbea T C 3: 55,626,908 Y2936C probably damaging Het
Nbeal1 A T 1: 60,268,383 I1685F probably damaging Het
Nt5c3 C G 6: 56,883,692 G293R probably damaging Het
Olfr1315-ps1 A T 2: 112,110,457 V265E probably benign Het
Olfr67 T A 7: 103,787,360 I306F probably benign Het
Pcnx2 A T 8: 125,887,260 V484E probably benign Het
Pcsk5 C T 19: 17,469,044 R1195Q probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pitpnm3 A G 11: 72,051,878 V861A probably benign Het
Pkd1 A G 17: 24,574,202 Y1621C probably damaging Het
Polr3e T C 7: 120,940,317 V455A possibly damaging Het
Prr5l C T 2: 101,741,378 G118D probably damaging Het
Pygl G T 12: 70,195,626 N685K probably damaging Het
Rfx8 A G 1: 39,718,440 V56A probably damaging Het
Sbf1 T C 15: 89,295,459 D1341G probably benign Het
Selenon T C 4: 134,548,019 T123A probably benign Het
Slc23a1 T G 18: 35,619,578 K549Q probably benign Het
Slc7a13 T C 4: 19,841,443 F430S probably damaging Het
Smarcc2 G A 10: 128,483,201 V707M probably damaging Het
St18 A G 1: 6,845,791 S887G probably damaging Het
T2 T C 17: 8,396,645 probably benign Het
Tbc1d16 A G 11: 119,210,666 L6P probably damaging Het
Tcf7l2 T C 19: 55,931,763 L576P possibly damaging Het
Tnr A G 1: 159,850,366 D107G probably benign Het
Trpv1 G T 11: 73,244,256 K426N probably damaging Het
Vmn1r15 A T 6: 57,258,910 L254F probably benign Het
Vmn1r219 A T 13: 23,163,021 I127F probably damaging Het
Zc3h14 A T 12: 98,758,572 E164D probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
R8785:Polr3a UTSW 14 24452315 missense probably benign 0.06
R8848:Polr3a UTSW 14 24450766 missense probably damaging 1.00
R9025:Polr3a UTSW 14 24469411 missense probably damaging 1.00
R9139:Polr3a UTSW 14 24469348 missense probably damaging 1.00
R9264:Polr3a UTSW 14 24470831 missense probably benign
R9309:Polr3a UTSW 14 24459999 missense probably benign
R9363:Polr3a UTSW 14 24450763 missense probably damaging 1.00
R9526:Polr3a UTSW 14 24453245 missense probably benign 0.00
R9585:Polr3a UTSW 14 24452221 missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCTTCAAACCCAAGGTGG -3'
(R):5'- TCTCTACTATAGGCAGTTCTTCAGC -3'

Sequencing Primer
(F):5'- CTTCAAACCCAAGGTGGTGGTAAG -3'
(R):5'- CCACTGGCTAGGAATGTGTAGC -3'
Posted On 2021-03-08