Mutagenetix > Incidental Mutation

Incidental Mutation 'R8754:A830018L16Rik'

664008

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R8754 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 11545248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 148 (K148N)

Ref Sequence

ENSEMBL: ENSMUSP00000117421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048613
AA Change: K148N

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: K148N

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135014
AA Change: K148N

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715
AA Change: K148N

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137824
AA Change: K148N

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: K148N

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121311
Gene: ENSMUSG00000057715
AA Change: K44N

Domain	Start	End	E-Value	Type
low complexity region	110	120	N/A	INTRINSIC
low complexity region	130	145	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141512
AA Change: K148N

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715
AA Change: K148N

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171690
AA Change: K148N

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715
AA Change: K148N

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179089
AA Change: K148N

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,037	V329A	probably benign	Het
Actn3	A	G	19: 4,863,460	F648L	probably damaging	Het
Amotl2	A	G	9: 102,720,159	D39G	possibly damaging	Het
Anks1	C	A	17: 27,996,010	T477K	possibly damaging	Het
Brix1	A	T	15: 10,476,578	S271T	probably benign	Het
Ccdc88b	T	C	19: 6,855,845	E278G	probably damaging	Het
Cdc40	C	T	10: 40,841,484	D404N	probably damaging	Het
Chrna6	T	C	8: 27,407,201	H216R	probably damaging	Het
Col6a3	C	G	1: 90,767,606		probably benign	Het
Copa	C	T	1: 172,108,359	R423W	probably damaging	Het
Cttnbp2	A	C	6: 18,434,038	I607R	possibly damaging	Het
Depdc5	A	T	5: 32,979,537	T1384S	probably benign	Het
Dlat	G	T	9: 50,649,667	A360E	probably damaging	Het
Dusp26	C	T	8: 31,091,777		probably benign	Het
Fam135a	G	A	1: 24,028,488	T1100M	probably benign	Het
Fuca1	T	C	4: 135,925,578	L171P	probably damaging	Het
Gm21936	T	A	12: 87,795,799	N96K	possibly damaging	Het
Gpr158	G	A	2: 21,576,882	V391I	probably benign	Het
Gtf2h5	C	CA	17: 6,084,558		probably null	Het
Heatr1	T	A	13: 12,413,294	Y771N	probably damaging	Het
Il17ra	A	G	6: 120,481,456	T523A	probably benign	Het
Kcnv1	G	A	15: 45,114,469	Q58*	probably null	Het
Kdm5d	T	C	Y: 941,594	V1265A	probably damaging	Het
Kifc3	A	T	8: 95,102,396	L726Q	probably damaging	Het
Klk1b21	T	A	7: 44,106,488	I247N	probably benign	Het
Kntc1	T	A	5: 123,759,052	N159K	probably benign	Het
Krtap4-7	G	T	11: 99,643,841	C65*	probably null	Het
Lama2	C	T	10: 27,001,151	V2680M	possibly damaging	Het
Lipe	T	A	7: 25,388,582	M61L	probably benign	Het
Med17	A	G	9: 15,277,600	M123T	possibly damaging	Het
Mrpl37	T	C	4: 107,064,414	N206S	probably benign	Het
Muc4	A	T	16: 32,781,986	N1390Y		Het
Muc5ac	C	T	7: 141,800,271	A869V	possibly damaging	Het
Nckap5l	A	G	15: 99,429,409	V133A	probably benign	Het
Nin	A	T	12: 70,031,013		probably benign	Het
Nr1h2	C	T	7: 44,551,344	A287T	probably damaging	Het
Olfr894	A	T	9: 38,219,569	I246L	possibly damaging	Het
Patl1	A	G	19: 11,922,534	E230G	probably damaging	Het
Pbxip1	T	C	3: 89,447,928	S585P	probably damaging	Het
Pde3b	T	A	7: 114,416,043	W165R	possibly damaging	Het
Pdia4	A	C	6: 47,796,530	D628E	probably benign	Het
Pigo	T	A	4: 43,024,724	H125L	probably benign	Het
Platr25	A	T	13: 62,700,110	*313K	probably null	Het
Plxdc1	A	T	11: 97,955,511	M169K	possibly damaging	Het
Pxk	T	C	14: 8,151,496	I437T	probably damaging	Het
Rlf	T	C	4: 121,146,813	T1767A	possibly damaging	Het
Rnf123	T	A	9: 108,071,164	D110V	probably damaging	Het
Rnf185	A	T	11: 3,418,052	F209I	probably benign	Het
Rpl4	A	T	9: 64,174,960	N47I	probably damaging	Het
Rsl1d1	A	T	16: 11,199,648	F151L	probably damaging	Het
Sema3d	T	C	5: 12,553,224		probably null	Het
Serhl	A	G	15: 83,101,925	N80D	probably benign	Het
Sh3tc1	C	A	5: 35,706,458	R795L	probably benign	Het
Slc2a12	A	T	10: 22,645,217	T7S	probably benign	Het
Snrnp200	A	G	2: 127,226,085	Y834C	probably damaging	Het
Ss18	G	C	18: 14,640,959	Q258E	probably damaging	Het
Telo2	G	A	17: 25,102,067	L725F	probably damaging	Het
Tnxb	A	G	17: 34,715,908	E2497G	probably damaging	Het
Tox2	A	G	2: 163,321,440	D111G		Het
Trim16	G	A	11: 62,840,937	E545K	probably benign	Het
Trpm7	A	G	2: 126,822,703	W919R	probably damaging	Het
Ttbk1	G	T	17: 46,445,201	S1301*	probably null	Het
Txk	T	C	5: 72,731,779	N144S	probably damaging	Het
Ubqln4	T	A	3: 88,565,783	V515E	probably benign	Het
Ush2a	C	T	1: 188,848,965	R3681*	probably null	Het
Ythdf3	A	T	3: 16,203,974	N106I	probably damaging	Het
Zfp367	A	T	13: 64,144,255	C187*	probably null	Het
Zfp735	A	G	11: 73,712,174	D648G	possibly damaging	Het
Zic1	T	C	9: 91,362,648		probably benign	Het
Zik1	A	G	7: 10,489,899	S424P	probably damaging	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8993:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9640:A830018L16Rik	UTSW	1	11950976	missense	probably damaging	0.98
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTCTTGCACAAATGATAAATGGTG -3'
(R):5'- TAGCTCCTGCCTGCTCACAG -3'

Sequencing Primer
(F):5'- GAGTTTTGTATCACTGTATGACATGC -3'
(R):5'- TCACAGATCTGTTCCATGGCACAG -3'

Posted On

2021-03-08