Incidental Mutation 'R8754:1110002E22Rik'
ID 664020
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 068620-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.545) question?
Stock # R8754 (G1)
Quality Score 215.009
Status Validated
Chromosome 3
Chromosomal Location 137770813-137787267 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137771798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 329 (V329A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: V329A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V329A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G T 1: 11,615,472 (GRCm39) K148N probably benign Het
Actn3 A G 19: 4,913,488 (GRCm39) F648L probably damaging Het
Amotl2 A G 9: 102,597,358 (GRCm39) D39G possibly damaging Het
Anks1 C A 17: 28,214,984 (GRCm39) T477K possibly damaging Het
Brix1 A T 15: 10,476,664 (GRCm39) S271T probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Chrna6 T C 8: 27,897,229 (GRCm39) H216R probably damaging Het
Col6a3 C G 1: 90,695,328 (GRCm39) probably benign Het
Copa C T 1: 171,935,926 (GRCm39) R423W probably damaging Het
Cttnbp2 A C 6: 18,434,037 (GRCm39) I607R possibly damaging Het
Depdc5 A T 5: 33,136,881 (GRCm39) T1384S probably benign Het
Dlat G T 9: 50,560,967 (GRCm39) A360E probably damaging Het
Dusp26 C T 8: 31,581,805 (GRCm39) probably benign Het
Eif1ad13 T A 12: 87,762,569 (GRCm39) N96K possibly damaging Het
Fam135a G A 1: 24,067,569 (GRCm39) T1100M probably benign Het
Fuca1 T C 4: 135,652,889 (GRCm39) L171P probably damaging Het
Gpr158 G A 2: 21,581,693 (GRCm39) V391I probably benign Het
Gtf2h5 C CA 17: 6,134,833 (GRCm39) probably null Het
Heatr1 T A 13: 12,428,175 (GRCm39) Y771N probably damaging Het
Il17ra A G 6: 120,458,417 (GRCm39) T523A probably benign Het
Kcnv1 G A 15: 44,977,865 (GRCm39) Q58* probably null Het
Kdm5d T C Y: 941,594 (GRCm39) V1265A probably damaging Het
Kifc3 A T 8: 95,829,024 (GRCm39) L726Q probably damaging Het
Klk1b21 T A 7: 43,755,912 (GRCm39) I247N probably benign Het
Kntc1 T A 5: 123,897,115 (GRCm39) N159K probably benign Het
Krtap4-7 G T 11: 99,534,667 (GRCm39) C65* probably null Het
Lama2 C T 10: 26,877,147 (GRCm39) V2680M possibly damaging Het
Lipe T A 7: 25,088,007 (GRCm39) M61L probably benign Het
Med17 A G 9: 15,188,896 (GRCm39) M123T possibly damaging Het
Mrpl37 T C 4: 106,921,611 (GRCm39) N206S probably benign Het
Muc4 A T 16: 32,602,356 (GRCm39) N1390Y Het
Muc5ac C T 7: 141,354,008 (GRCm39) A869V possibly damaging Het
Nckap5l A G 15: 99,327,290 (GRCm39) V133A probably benign Het
Nin A T 12: 70,077,787 (GRCm39) probably benign Het
Nr1h2 C T 7: 44,200,768 (GRCm39) A287T probably damaging Het
Or8c16 A T 9: 38,130,865 (GRCm39) I246L possibly damaging Het
Patl1 A G 19: 11,899,898 (GRCm39) E230G probably damaging Het
Pbxip1 T C 3: 89,355,235 (GRCm39) S585P probably damaging Het
Pde3b T A 7: 114,015,278 (GRCm39) W165R possibly damaging Het
Pdia4 A C 6: 47,773,464 (GRCm39) D628E probably benign Het
Pigo T A 4: 43,024,724 (GRCm39) H125L probably benign Het
Platr25 A T 13: 62,847,924 (GRCm39) *313K probably null Het
Plxdc1 A T 11: 97,846,337 (GRCm39) M169K possibly damaging Het
Pxk T C 14: 8,151,496 (GRCm38) I437T probably damaging Het
Rlf T C 4: 121,004,010 (GRCm39) T1767A possibly damaging Het
Rnf123 T A 9: 107,948,363 (GRCm39) D110V probably damaging Het
Rnf185 A T 11: 3,368,052 (GRCm39) F209I probably benign Het
Rpl4 A T 9: 64,082,242 (GRCm39) N47I probably damaging Het
Rsl1d1 A T 16: 11,017,512 (GRCm39) F151L probably damaging Het
Sema3d T C 5: 12,603,191 (GRCm39) probably null Het
Serhl A G 15: 82,986,126 (GRCm39) N80D probably benign Het
Sh3tc1 C A 5: 35,863,802 (GRCm39) R795L probably benign Het
Slc2a12 A T 10: 22,521,116 (GRCm39) T7S probably benign Het
Snrnp200 A G 2: 127,068,005 (GRCm39) Y834C probably damaging Het
Ss18 G C 18: 14,774,016 (GRCm39) Q258E probably damaging Het
Telo2 G A 17: 25,321,041 (GRCm39) L725F probably damaging Het
Tnxb A G 17: 34,934,882 (GRCm39) E2497G probably damaging Het
Tox2 A G 2: 163,163,360 (GRCm39) D111G Het
Trim16 G A 11: 62,731,763 (GRCm39) E545K probably benign Het
Trpm7 A G 2: 126,664,623 (GRCm39) W919R probably damaging Het
Ttbk1 G T 17: 46,756,127 (GRCm39) S1301* probably null Het
Txk T C 5: 72,889,122 (GRCm39) N144S probably damaging Het
Ubqln4 T A 3: 88,473,090 (GRCm39) V515E probably benign Het
Ush2a C T 1: 188,581,162 (GRCm39) R3681* probably null Het
Ythdf3 A T 3: 16,258,138 (GRCm39) N106I probably damaging Het
Zfp367 A T 13: 64,292,069 (GRCm39) C187* probably null Het
Zfp735 A G 11: 73,603,000 (GRCm39) D648G possibly damaging Het
Zic1 T C 9: 91,244,701 (GRCm39) probably benign Het
Zik1 A G 7: 10,223,826 (GRCm39) S424P probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 137,772,566 (GRCm39) missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 137,772,025 (GRCm39) missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 137,772,025 (GRCm39) missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 137,773,874 (GRCm39) missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 137,773,874 (GRCm39) missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 137,775,632 (GRCm39) missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 137,771,595 (GRCm39) small deletion probably benign
R0394:1110002E22Rik UTSW 3 137,773,065 (GRCm39) missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 137,776,067 (GRCm39) missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 137,774,005 (GRCm39) missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 137,774,704 (GRCm39) nonsense probably null
R0711:1110002E22Rik UTSW 3 137,773,986 (GRCm39) missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 137,775,632 (GRCm39) missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 137,775,838 (GRCm39) missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 137,772,967 (GRCm39) missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 137,772,632 (GRCm39) missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 137,773,661 (GRCm39) missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 137,773,313 (GRCm39) missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 137,771,162 (GRCm39) missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 137,775,181 (GRCm39) missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 137,772,479 (GRCm39) missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 137,773,031 (GRCm39) missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 137,773,028 (GRCm39) missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 137,771,419 (GRCm39) nonsense probably null
R1991:1110002E22Rik UTSW 3 137,771,419 (GRCm39) nonsense probably null
R2102:1110002E22Rik UTSW 3 137,770,934 (GRCm39) missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 137,773,541 (GRCm39) missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 137,771,443 (GRCm39) missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 137,774,168 (GRCm39) missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 137,772,400 (GRCm39) missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 137,773,834 (GRCm39) missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 137,776,027 (GRCm39) missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 137,775,520 (GRCm39) missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 137,774,246 (GRCm39) missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 137,775,751 (GRCm39) missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 137,771,503 (GRCm39) missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 137,771,131 (GRCm39) missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 137,771,437 (GRCm39) missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 137,774,780 (GRCm39) missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 137,775,433 (GRCm39) missense probably benign
R5206:1110002E22Rik UTSW 3 137,772,272 (GRCm39) missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 137,771,611 (GRCm39) missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 137,773,396 (GRCm39) missense probably benign
R5374:1110002E22Rik UTSW 3 137,773,396 (GRCm39) missense probably benign
R5506:1110002E22Rik UTSW 3 137,773,708 (GRCm39) missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 137,772,260 (GRCm39) missense probably benign
R5536:1110002E22Rik UTSW 3 137,772,149 (GRCm39) missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 137,771,170 (GRCm39) missense probably benign
R5759:1110002E22Rik UTSW 3 137,774,419 (GRCm39) missense probably benign
R5933:1110002E22Rik UTSW 3 137,776,109 (GRCm39) missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 137,775,922 (GRCm39) missense probably benign
R6092:1110002E22Rik UTSW 3 137,774,701 (GRCm39) missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 137,773,741 (GRCm39) missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 137,772,383 (GRCm39) missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 137,772,736 (GRCm39) missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 137,774,561 (GRCm39) missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 137,773,288 (GRCm39) missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 137,772,386 (GRCm39) missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 137,774,915 (GRCm39) missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 137,771,971 (GRCm39) missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 137,770,930 (GRCm39) nonsense probably null
R6920:1110002E22Rik UTSW 3 137,773,811 (GRCm39) missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 137,771,272 (GRCm39) missense probably benign
R7145:1110002E22Rik UTSW 3 137,775,820 (GRCm39) missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 137,775,712 (GRCm39) missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 137,771,237 (GRCm39) missense probably benign
R7425:1110002E22Rik UTSW 3 137,771,456 (GRCm39) missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 137,772,629 (GRCm39) missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 137,774,044 (GRCm39) nonsense probably null
R7663:1110002E22Rik UTSW 3 137,771,887 (GRCm39) missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 137,774,516 (GRCm39) missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 137,775,362 (GRCm39) missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 137,774,156 (GRCm39) missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 137,773,543 (GRCm39) missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 137,772,211 (GRCm39) missense probably benign
R8434:1110002E22Rik UTSW 3 137,773,021 (GRCm39) missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 137,774,586 (GRCm39) missense probably damaging 0.99
R8808:1110002E22Rik UTSW 3 137,775,874 (GRCm39) missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 137,772,520 (GRCm39) nonsense probably null
R9026:1110002E22Rik UTSW 3 137,770,909 (GRCm39) missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 137,775,677 (GRCm39) missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 137,772,389 (GRCm39) missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 137,772,464 (GRCm39) missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 137,771,839 (GRCm39) missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 137,771,183 (GRCm39) missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 137,772,048 (GRCm39) missense probably benign 0.00
R9509:1110002E22Rik UTSW 3 137,771,595 (GRCm39) small deletion probably benign
R9582:1110002E22Rik UTSW 3 137,772,766 (GRCm39) missense probably damaging 0.99
R9599:1110002E22Rik UTSW 3 137,774,267 (GRCm39) missense probably benign 0.16
R9613:1110002E22Rik UTSW 3 137,771,126 (GRCm39) missense probably damaging 0.98
R9670:1110002E22Rik UTSW 3 137,770,894 (GRCm39) missense probably benign
X0003:1110002E22Rik UTSW 3 137,774,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGAAGACAATGGCCTTTC -3'
(R):5'- GGTCTCATCACTGCCACCAAAG -3'

Sequencing Primer
(F):5'- TCCAAAATGGACGATCCCAC -3'
(R):5'- GTCCACGAATGAATAGATCACGTTG -3'
Posted On 2021-03-08