Incidental Mutation 'R8754:1110002E22Rik'
ID 664020
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R8754 (G1)
Quality Score 215.009
Status Validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138066037 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 329 (V329A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: V329A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V329A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G T 1: 11,545,248 K148N probably benign Het
Actn3 A G 19: 4,863,460 F648L probably damaging Het
Amotl2 A G 9: 102,720,159 D39G possibly damaging Het
Anks1 C A 17: 27,996,010 T477K possibly damaging Het
Brix1 A T 15: 10,476,578 S271T probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Chrna6 T C 8: 27,407,201 H216R probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Copa C T 1: 172,108,359 R423W probably damaging Het
Cttnbp2 A C 6: 18,434,038 I607R possibly damaging Het
Depdc5 A T 5: 32,979,537 T1384S probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dusp26 C T 8: 31,091,777 probably benign Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fuca1 T C 4: 135,925,578 L171P probably damaging Het
Gm21936 T A 12: 87,795,799 N96K possibly damaging Het
Gpr158 G A 2: 21,576,882 V391I probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Heatr1 T A 13: 12,413,294 Y771N probably damaging Het
Il17ra A G 6: 120,481,456 T523A probably benign Het
Kcnv1 G A 15: 45,114,469 Q58* probably null Het
Kdm5d T C Y: 941,594 V1265A probably damaging Het
Kifc3 A T 8: 95,102,396 L726Q probably damaging Het
Klk1b21 T A 7: 44,106,488 I247N probably benign Het
Kntc1 T A 5: 123,759,052 N159K probably benign Het
Krtap4-7 G T 11: 99,643,841 C65* probably null Het
Lama2 C T 10: 27,001,151 V2680M possibly damaging Het
Lipe T A 7: 25,388,582 M61L probably benign Het
Med17 A G 9: 15,277,600 M123T possibly damaging Het
Mrpl37 T C 4: 107,064,414 N206S probably benign Het
Muc4 A T 16: 32,781,986 N1390Y Het
Muc5ac C T 7: 141,800,271 A869V possibly damaging Het
Nckap5l A G 15: 99,429,409 V133A probably benign Het
Nin A T 12: 70,031,013 probably benign Het
Nr1h2 C T 7: 44,551,344 A287T probably damaging Het
Olfr894 A T 9: 38,219,569 I246L possibly damaging Het
Patl1 A G 19: 11,922,534 E230G probably damaging Het
Pbxip1 T C 3: 89,447,928 S585P probably damaging Het
Pde3b T A 7: 114,416,043 W165R possibly damaging Het
Pdia4 A C 6: 47,796,530 D628E probably benign Het
Pigo T A 4: 43,024,724 H125L probably benign Het
Platr25 A T 13: 62,700,110 *313K probably null Het
Plxdc1 A T 11: 97,955,511 M169K possibly damaging Het
Pxk T C 14: 8,151,496 I437T probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Rnf123 T A 9: 108,071,164 D110V probably damaging Het
Rnf185 A T 11: 3,418,052 F209I probably benign Het
Rpl4 A T 9: 64,174,960 N47I probably damaging Het
Rsl1d1 A T 16: 11,199,648 F151L probably damaging Het
Sema3d T C 5: 12,553,224 probably null Het
Serhl A G 15: 83,101,925 N80D probably benign Het
Sh3tc1 C A 5: 35,706,458 R795L probably benign Het
Slc2a12 A T 10: 22,645,217 T7S probably benign Het
Snrnp200 A G 2: 127,226,085 Y834C probably damaging Het
Ss18 G C 18: 14,640,959 Q258E probably damaging Het
Telo2 G A 17: 25,102,067 L725F probably damaging Het
Tnxb A G 17: 34,715,908 E2497G probably damaging Het
Tox2 A G 2: 163,321,440 D111G Het
Trim16 G A 11: 62,840,937 E545K probably benign Het
Trpm7 A G 2: 126,822,703 W919R probably damaging Het
Ttbk1 G T 17: 46,445,201 S1301* probably null Het
Txk T C 5: 72,731,779 N144S probably damaging Het
Ubqln4 T A 3: 88,565,783 V515E probably benign Het
Ush2a C T 1: 188,848,965 R3681* probably null Het
Ythdf3 A T 3: 16,203,974 N106I probably damaging Het
Zfp367 A T 13: 64,144,255 C187* probably null Het
Zfp735 A G 11: 73,712,174 D648G possibly damaging Het
Zic1 T C 9: 91,362,648 probably benign Het
Zik1 A G 7: 10,489,899 S424P probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGAAGACAATGGCCTTTC -3'
(R):5'- GGTCTCATCACTGCCACCAAAG -3'

Sequencing Primer
(F):5'- TCCAAAATGGACGATCCCAC -3'
(R):5'- GTCCACGAATGAATAGATCACGTTG -3'
Posted On 2021-03-08