Incidental Mutation 'R8754:Rnf123'
ID 664047
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R8754 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108071164 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 110 (D110V)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: D110V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161828
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: D110V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,037 V329A probably benign Het
A830018L16Rik G T 1: 11,545,248 K148N probably benign Het
Actn3 A G 19: 4,863,460 F648L probably damaging Het
Amotl2 A G 9: 102,720,159 D39G possibly damaging Het
Anks1 C A 17: 27,996,010 T477K possibly damaging Het
Brix1 A T 15: 10,476,578 S271T probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Chrna6 T C 8: 27,407,201 H216R probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Copa C T 1: 172,108,359 R423W probably damaging Het
Cttnbp2 A C 6: 18,434,038 I607R possibly damaging Het
Depdc5 A T 5: 32,979,537 T1384S probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dusp26 C T 8: 31,091,777 probably benign Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fuca1 T C 4: 135,925,578 L171P probably damaging Het
Gm21936 T A 12: 87,795,799 N96K possibly damaging Het
Gpr158 G A 2: 21,576,882 V391I probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Heatr1 T A 13: 12,413,294 Y771N probably damaging Het
Il17ra A G 6: 120,481,456 T523A probably benign Het
Kcnv1 G A 15: 45,114,469 Q58* probably null Het
Kdm5d T C Y: 941,594 V1265A probably damaging Het
Kifc3 A T 8: 95,102,396 L726Q probably damaging Het
Klk1b21 T A 7: 44,106,488 I247N probably benign Het
Kntc1 T A 5: 123,759,052 N159K probably benign Het
Krtap4-7 G T 11: 99,643,841 C65* probably null Het
Lama2 C T 10: 27,001,151 V2680M possibly damaging Het
Lipe T A 7: 25,388,582 M61L probably benign Het
Med17 A G 9: 15,277,600 M123T possibly damaging Het
Mrpl37 T C 4: 107,064,414 N206S probably benign Het
Muc4 A T 16: 32,781,986 N1390Y Het
Muc5ac C T 7: 141,800,271 A869V possibly damaging Het
Nckap5l A G 15: 99,429,409 V133A probably benign Het
Nin A T 12: 70,031,013 probably benign Het
Nr1h2 C T 7: 44,551,344 A287T probably damaging Het
Olfr894 A T 9: 38,219,569 I246L possibly damaging Het
Patl1 A G 19: 11,922,534 E230G probably damaging Het
Pbxip1 T C 3: 89,447,928 S585P probably damaging Het
Pde3b T A 7: 114,416,043 W165R possibly damaging Het
Pdia4 A C 6: 47,796,530 D628E probably benign Het
Pigo T A 4: 43,024,724 H125L probably benign Het
Platr25 A T 13: 62,700,110 *313K probably null Het
Plxdc1 A T 11: 97,955,511 M169K possibly damaging Het
Pxk T C 14: 8,151,496 I437T probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Rnf185 A T 11: 3,418,052 F209I probably benign Het
Rpl4 A T 9: 64,174,960 N47I probably damaging Het
Rsl1d1 A T 16: 11,199,648 F151L probably damaging Het
Sema3d T C 5: 12,553,224 probably null Het
Serhl A G 15: 83,101,925 N80D probably benign Het
Sh3tc1 C A 5: 35,706,458 R795L probably benign Het
Slc2a12 A T 10: 22,645,217 T7S probably benign Het
Snrnp200 A G 2: 127,226,085 Y834C probably damaging Het
Ss18 G C 18: 14,640,959 Q258E probably damaging Het
Telo2 G A 17: 25,102,067 L725F probably damaging Het
Tnxb A G 17: 34,715,908 E2497G probably damaging Het
Tox2 A G 2: 163,321,440 D111G Het
Trim16 G A 11: 62,840,937 E545K probably benign Het
Trpm7 A G 2: 126,822,703 W919R probably damaging Het
Ttbk1 G T 17: 46,445,201 S1301* probably null Het
Txk T C 5: 72,731,779 N144S probably damaging Het
Ubqln4 T A 3: 88,565,783 V515E probably benign Het
Ush2a C T 1: 188,848,965 R3681* probably null Het
Ythdf3 A T 3: 16,203,974 N106I probably damaging Het
Zfp367 A T 13: 64,144,255 C187* probably null Het
Zfp735 A G 11: 73,712,174 D648G possibly damaging Het
Zic1 T C 9: 91,362,648 probably benign Het
Zik1 A G 7: 10,489,899 S424P probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACATGATGGGACTCTGGG -3'
(R):5'- TCAAAGCCTGGAGTTCTCTGC -3'

Sequencing Primer
(F):5'- ACTCTGGGCTTTGCTGAAAG -3'
(R):5'- GGAGTTCTCTGCACAGCTCATG -3'
Posted On 2021-03-08