Incidental Mutation 'R8754:Rnf123'
ID664047
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Namering finger protein 123
SynonymsKPC1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R8754 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108051534-108083346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108071164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 110 (D110V)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: D110V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161828
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: D110V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: D110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,037 V329A probably benign Het
A830018L16Rik G T 1: 11,545,248 K148N probably benign Het
Actn3 A G 19: 4,863,460 F648L probably damaging Het
Amotl2 A G 9: 102,720,159 D39G possibly damaging Het
Anks1 C A 17: 27,996,010 T477K possibly damaging Het
Brix1 A T 15: 10,476,578 S271T probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Chrna6 T C 8: 27,407,201 H216R probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Copa C T 1: 172,108,359 R423W probably damaging Het
Cttnbp2 A C 6: 18,434,038 I607R possibly damaging Het
Depdc5 A T 5: 32,979,537 T1384S probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dusp26 C T 8: 31,091,777 probably benign Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fuca1 T C 4: 135,925,578 L171P probably damaging Het
Gm21936 T A 12: 87,795,799 N96K possibly damaging Het
Gpr158 G A 2: 21,576,882 V391I probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Heatr1 T A 13: 12,413,294 Y771N probably damaging Het
Il17ra A G 6: 120,481,456 T523A probably benign Het
Kcnv1 G A 15: 45,114,469 Q58* probably null Het
Kdm5d T C Y: 941,594 V1265A probably damaging Het
Kifc3 A T 8: 95,102,396 L726Q probably damaging Het
Klk1b21 T A 7: 44,106,488 I247N probably benign Het
Kntc1 T A 5: 123,759,052 N159K probably benign Het
Krtap4-7 G T 11: 99,643,841 C65* probably null Het
Lama2 C T 10: 27,001,151 V2680M possibly damaging Het
Lipe T A 7: 25,388,582 M61L probably benign Het
Med17 A G 9: 15,277,600 M123T possibly damaging Het
Mrpl37 T C 4: 107,064,414 N206S probably benign Het
Muc4 A T 16: 32,781,986 N1390Y Het
Muc5ac C T 7: 141,800,271 A869V possibly damaging Het
Nckap5l A G 15: 99,429,409 V133A probably benign Het
Nr1h2 C T 7: 44,551,344 A287T probably damaging Het
Olfr894 A T 9: 38,219,569 I246L possibly damaging Het
Patl1 A G 19: 11,922,534 E230G probably damaging Het
Pbxip1 T C 3: 89,447,928 S585P probably damaging Het
Pde3b T A 7: 114,416,043 W165R possibly damaging Het
Pdia4 A C 6: 47,796,530 D628E probably benign Het
Pigo T A 4: 43,024,724 H125L probably benign Het
Platr25 A T 13: 62,700,110 *313K probably null Het
Plxdc1 A T 11: 97,955,511 M169K possibly damaging Het
Pxk T C 14: 8,151,496 I437T probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Rnf185 A T 11: 3,418,052 F209I probably benign Het
Rpl4 A T 9: 64,174,960 N47I probably damaging Het
Rsl1d1 A T 16: 11,199,648 F151L probably damaging Het
Sema3d T C 5: 12,553,224 probably null Het
Serhl A G 15: 83,101,925 N80D probably benign Het
Sh3tc1 C A 5: 35,706,458 R795L probably benign Het
Slc2a12 A T 10: 22,645,217 T7S probably benign Het
Snrnp200 A G 2: 127,226,085 Y834C probably damaging Het
Ss18 G C 18: 14,640,959 Q258E probably damaging Het
Telo2 G A 17: 25,102,067 L725F probably damaging Het
Tnxb A G 17: 34,715,908 E2497G probably damaging Het
Tox2 A G 2: 163,321,440 D111G Het
Trim16 G A 11: 62,840,937 E545K probably benign Het
Trpm7 A G 2: 126,822,703 W919R probably damaging Het
Ttbk1 G T 17: 46,445,201 S1301* probably null Het
Txk T C 5: 72,731,779 N144S probably damaging Het
Ubqln4 T A 3: 88,565,783 V515E probably benign Het
Ush2a C T 1: 188,848,965 R3681* probably null Het
Ythdf3 A T 3: 16,203,974 N106I probably damaging Het
Zfp367 A T 13: 64,144,255 C187* probably null Het
Zfp735 A G 11: 73,712,174 D648G possibly damaging Het
Zik1 A G 7: 10,489,899 S424P probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8783:Rnf123 UTSW 9 108069073 missense probably benign
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACATGATGGGACTCTGGG -3'
(R):5'- TCAAAGCCTGGAGTTCTCTGC -3'

Sequencing Primer
(F):5'- ACTCTGGGCTTTGCTGAAAG -3'
(R):5'- GGAGTTCTCTGCACAGCTCATG -3'
Posted On2021-03-08