Incidental Mutation 'R8754:Telo2'
ID664068
Institutional Source Beutler Lab
Gene Symbol Telo2
Ensembl Gene ENSMUSG00000024170
Gene Nametelomere maintenance 2
Synonyms1200003M09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8754 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25099570-25115967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25102067 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 725 (L725F)
Ref Sequence ENSEMBL: ENSMUSP00000024987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024987] [ENSMUST00000115181]
PDB Structure PIH1 N-terminal domain [X-RAY DIFFRACTION]
PIH N-terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000024983
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000024987
AA Change: L725F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170
AA Change: L725F

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115181
AA Change: L725F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170
AA Change: L725F

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as an S-phase checkpoint protein in the cell cycle. The protein may also play a role in DNA repair.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,037 V329A probably benign Het
A830018L16Rik G T 1: 11,545,248 K148N probably benign Het
Actn3 A G 19: 4,863,460 F648L probably damaging Het
Amotl2 A G 9: 102,720,159 D39G possibly damaging Het
Anks1 C A 17: 27,996,010 T477K possibly damaging Het
Brix1 A T 15: 10,476,578 S271T probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Chrna6 T C 8: 27,407,201 H216R probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Copa C T 1: 172,108,359 R423W probably damaging Het
Cttnbp2 A C 6: 18,434,038 I607R possibly damaging Het
Depdc5 A T 5: 32,979,537 T1384S probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dusp26 C T 8: 31,091,777 probably benign Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fuca1 T C 4: 135,925,578 L171P probably damaging Het
Gm21936 T A 12: 87,795,799 N96K possibly damaging Het
Gpr158 G A 2: 21,576,882 V391I probably benign Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Heatr1 T A 13: 12,413,294 Y771N probably damaging Het
Il17ra A G 6: 120,481,456 T523A probably benign Het
Kcnv1 G A 15: 45,114,469 Q58* probably null Het
Kdm5d T C Y: 941,594 V1265A probably damaging Het
Kifc3 A T 8: 95,102,396 L726Q probably damaging Het
Klk1b21 T A 7: 44,106,488 I247N probably benign Het
Kntc1 T A 5: 123,759,052 N159K probably benign Het
Krtap4-7 G T 11: 99,643,841 C65* probably null Het
Lama2 C T 10: 27,001,151 V2680M possibly damaging Het
Lipe T A 7: 25,388,582 M61L probably benign Het
Med17 A G 9: 15,277,600 M123T possibly damaging Het
Mrpl37 T C 4: 107,064,414 N206S probably benign Het
Muc4 A T 16: 32,781,986 N1390Y Het
Muc5ac C T 7: 141,800,271 A869V possibly damaging Het
Nckap5l A G 15: 99,429,409 V133A probably benign Het
Nr1h2 C T 7: 44,551,344 A287T probably damaging Het
Olfr894 A T 9: 38,219,569 I246L possibly damaging Het
Patl1 A G 19: 11,922,534 E230G probably damaging Het
Pbxip1 T C 3: 89,447,928 S585P probably damaging Het
Pde3b T A 7: 114,416,043 W165R possibly damaging Het
Pdia4 A C 6: 47,796,530 D628E probably benign Het
Pigo T A 4: 43,024,724 H125L probably benign Het
Platr25 A T 13: 62,700,110 *313K probably null Het
Plxdc1 A T 11: 97,955,511 M169K possibly damaging Het
Pxk T C 14: 8,151,496 I437T probably damaging Het
Rlf T C 4: 121,146,813 T1767A possibly damaging Het
Rnf123 T A 9: 108,071,164 D110V probably damaging Het
Rnf185 A T 11: 3,418,052 F209I probably benign Het
Rpl4 A T 9: 64,174,960 N47I probably damaging Het
Rsl1d1 A T 16: 11,199,648 F151L probably damaging Het
Sema3d T C 5: 12,553,224 probably null Het
Serhl A G 15: 83,101,925 N80D probably benign Het
Sh3tc1 C A 5: 35,706,458 R795L probably benign Het
Slc2a12 A T 10: 22,645,217 T7S probably benign Het
Snrnp200 A G 2: 127,226,085 Y834C probably damaging Het
Ss18 G C 18: 14,640,959 Q258E probably damaging Het
Tnxb A G 17: 34,715,908 E2497G probably damaging Het
Tox2 A G 2: 163,321,440 D111G Het
Trim16 G A 11: 62,840,937 E545K probably benign Het
Trpm7 A G 2: 126,822,703 W919R probably damaging Het
Ttbk1 G T 17: 46,445,201 S1301* probably null Het
Txk T C 5: 72,731,779 N144S probably damaging Het
Ubqln4 T A 3: 88,565,783 V515E probably benign Het
Ush2a C T 1: 188,848,965 R3681* probably null Het
Ythdf3 A T 3: 16,203,974 N106I probably damaging Het
Zfp367 A T 13: 64,144,255 C187* probably null Het
Zfp735 A G 11: 73,712,174 D648G possibly damaging Het
Zik1 A G 7: 10,489,899 S424P probably damaging Het
Other mutations in Telo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Telo2 APN 17 25100129 splice site probably benign
IGL01398:Telo2 APN 17 25105774 missense probably benign 0.00
IGL01878:Telo2 APN 17 25101358 missense probably benign 0.19
IGL02728:Telo2 APN 17 25104654 missense probably damaging 1.00
R0669:Telo2 UTSW 17 25105823 missense probably benign 0.01
R0671:Telo2 UTSW 17 25113165 missense probably benign 0.00
R1783:Telo2 UTSW 17 25102738 splice site probably null
R1869:Telo2 UTSW 17 25114994 missense probably benign 0.32
R1988:Telo2 UTSW 17 25101668 missense probably benign 0.04
R2018:Telo2 UTSW 17 25105408 missense probably damaging 1.00
R2167:Telo2 UTSW 17 25110818 missense probably benign
R2219:Telo2 UTSW 17 25103699 missense probably benign 0.00
R3421:Telo2 UTSW 17 25110752 missense probably damaging 0.99
R3880:Telo2 UTSW 17 25106833 missense probably damaging 1.00
R4190:Telo2 UTSW 17 25102013 missense probably benign 0.00
R4299:Telo2 UTSW 17 25115256 missense possibly damaging 0.94
R4574:Telo2 UTSW 17 25101673 missense probably damaging 1.00
R4600:Telo2 UTSW 17 25105148 missense possibly damaging 0.79
R6010:Telo2 UTSW 17 25104878 missense possibly damaging 0.79
R6185:Telo2 UTSW 17 25102040 missense probably benign 0.29
R6513:Telo2 UTSW 17 25101412 missense probably damaging 1.00
R7352:Telo2 UTSW 17 25102069 missense probably damaging 1.00
R7538:Telo2 UTSW 17 25110821 missense probably benign 0.08
R8347:Telo2 UTSW 17 25104637 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGTATTCTGCGGGTCCAG -3'
(R):5'- AAATGCCTTCCCCTTGTGGC -3'

Sequencing Primer
(F):5'- ATTCTGCGGGTCCAGTGCTC -3'
(R):5'- TTTGCCACACTGGTCCAGG -3'
Posted On2021-03-08