Incidental Mutation 'R8755:Flg2'
ID 664088
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 068596-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R8755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93108120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 49 (D49E)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: D49E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: D49E

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,255,520 (GRCm39) D86E probably benign Het
Akap3 A G 6: 126,843,130 (GRCm39) D583G possibly damaging Het
Alms1 T A 6: 85,598,556 (GRCm39) D1127E probably benign Het
Anks4b T A 7: 119,773,307 (GRCm39) probably null Het
Ano8 A T 8: 71,935,724 (GRCm39) F298Y probably benign Het
Arhgef2 C A 3: 88,536,850 (GRCm39) Q7K probably benign Het
Brd10 T C 19: 29,693,890 (GRCm39) I1868V probably benign Het
Cand2 T C 6: 115,769,941 (GRCm39) L917P probably damaging Het
Car8 T C 4: 8,238,083 (GRCm39) D44G probably benign Het
Cdk1 T C 10: 69,176,435 (GRCm39) N224S probably benign Het
Cep162 T C 9: 87,114,064 (GRCm39) E336G probably benign Het
Chd7 T C 4: 8,866,069 (GRCm39) M2792T probably benign Het
Cyp4f40 A T 17: 32,886,957 (GRCm39) K143* probably null Het
Cyth1 T A 11: 118,074,768 (GRCm39) M178L probably benign Het
Dcaf11 C T 14: 55,798,023 (GRCm39) probably benign Het
Dlec1 T G 9: 118,967,225 (GRCm39) W1203G probably damaging Het
Fgd4 A T 16: 16,302,133 (GRCm39) S141T probably benign Het
Firrm A G 1: 163,786,895 (GRCm39) S725P probably damaging Het
Fyb2 T A 4: 104,861,086 (GRCm39) D647E unknown Het
Gstp1 T C 19: 4,086,698 (GRCm39) Y109C probably damaging Het
Gtf3c3 T C 1: 54,468,031 (GRCm39) E202G probably benign Het
Hephl1 A G 9: 14,985,563 (GRCm39) F698L probably benign Het
Hephl1 G T 9: 15,023,280 (GRCm39) P41T probably damaging Het
Hmcn1 T A 1: 150,509,371 (GRCm39) E3659V probably benign Het
Il27ra A T 8: 84,765,988 (GRCm39) D229E probably damaging Het
Itih2 T A 2: 10,103,369 (GRCm39) D706V probably damaging Het
Itpr2 A T 6: 146,133,926 (GRCm39) C1893S probably benign Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Laptm4b A G 15: 34,273,420 (GRCm39) D111G probably damaging Het
Ldb3 T A 14: 34,299,256 (GRCm39) S123C probably damaging Het
Lgals12 C T 19: 7,581,345 (GRCm39) E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 (GRCm39) S296R possibly damaging Het
Mpeg1 T C 19: 12,439,238 (GRCm39) F232S probably damaging Het
Ncapd2 A T 6: 125,148,817 (GRCm39) C990S possibly damaging Het
Nckap5 A T 1: 125,954,279 (GRCm39) C758S possibly damaging Het
Nwd1 A T 8: 73,394,192 (GRCm39) D485V probably damaging Het
Or13a21 T G 7: 139,999,417 (GRCm39) S90R probably benign Het
Or6c2 T C 10: 129,362,332 (GRCm39) F79L possibly damaging Het
Or8g50 T A 9: 39,648,786 (GRCm39) I225N probably damaging Het
Pcgf3 G A 5: 108,634,108 (GRCm39) R122Q probably benign Het
Pgm5 T A 19: 24,812,212 (GRCm39) I107F probably damaging Het
Pid1 G T 1: 84,016,066 (GRCm39) H114N probably damaging Het
Pkdrej T C 15: 85,703,807 (GRCm39) T710A probably benign Het
Plpbp T A 8: 27,535,165 (GRCm39) probably null Het
Ppfibp2 T G 7: 107,343,432 (GRCm39) F824V probably damaging Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Psg17 T A 7: 18,550,836 (GRCm39) T340S possibly damaging Het
Pstpip2 T C 18: 77,961,133 (GRCm39) S239P probably damaging Het
Ralbp1 A C 17: 66,166,036 (GRCm39) S383A possibly damaging Het
Ranbp2 T A 10: 58,300,969 (GRCm39) L613* probably null Het
Rgs11 T C 17: 26,422,346 (GRCm39) V49A probably damaging Het
Ryr1 C T 7: 28,791,693 (GRCm39) V1404I probably benign Het
Secisbp2 G A 13: 51,833,869 (GRCm39) V670I possibly damaging Het
Slc22a13 T A 9: 119,038,126 (GRCm39) M1L probably damaging Het
Slc5a1 A T 5: 33,316,526 (GRCm39) I591L probably benign Het
Tacr2 T A 10: 62,088,733 (GRCm39) V46E possibly damaging Het
Tet2 C T 3: 133,194,039 (GRCm39) G132S probably damaging Het
Thsd7a G A 6: 12,408,851 (GRCm39) R724* probably null Het
Tmco3 A T 8: 13,341,782 (GRCm39) I19L probably benign Het
Tnfrsf1a T A 6: 125,334,768 (GRCm39) L14Q probably benign Het
Tpm1 A T 9: 66,935,371 (GRCm39) L248Q probably benign Het
Tprn T A 2: 25,154,027 (GRCm39) I443N probably benign Het
Unc80 A T 1: 66,651,290 (GRCm39) H1545L possibly damaging Het
Vmn2r97 T A 17: 19,168,104 (GRCm39) M786K probably damaging Het
Wipi1 C T 11: 109,494,645 (GRCm39) V63M probably damaging Het
Zcchc4 G A 5: 52,976,724 (GRCm39) R506H unknown Het
Zfand6 A T 7: 84,281,899 (GRCm39) V110E probably benign Het
Zfp866 A T 8: 70,219,381 (GRCm39) Y80N possibly damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCACTCAAGCTTCCCATC -3'
(R):5'- AAACCTGATTTCTGTCTTGGTGTC -3'

Sequencing Primer
(F):5'- TGTGCTAACAAATTGATCGATTGATC -3'
(R):5'- CCTCTTGGTGTTGATGGCCAC -3'
Posted On 2021-03-08