Incidental Mutation 'R8755:Flg2'
ID 664088
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93197278-93221391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93200813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 49 (D49E)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: D49E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: D49E

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
R9214:Flg2 UTSW 3 93203577 missense unknown
R9231:Flg2 UTSW 3 93202201 missense unknown
R9553:Flg2 UTSW 3 93214594 missense unknown
R9607:Flg2 UTSW 3 93201412 missense probably damaging 0.98
R9735:Flg2 UTSW 3 93220362 missense unknown
R9752:Flg2 UTSW 3 93201160 missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCACTCAAGCTTCCCATC -3'
(R):5'- AAACCTGATTTCTGTCTTGGTGTC -3'

Sequencing Primer
(F):5'- TGTGCTAACAAATTGATCGATTGATC -3'
(R):5'- CCTCTTGGTGTTGATGGCCAC -3'
Posted On 2021-03-08