Incidental Mutation 'R8755:Fyb2'
ID664092
Institutional Source Beutler Lab
Gene Symbol Fyb2
Ensembl Gene ENSMUSG00000078612
Gene NameFYN binding protein 2
Synonyms1700024P16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8755 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location104913456-105016863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105003889 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 647 (D647E)
Ref Sequence ENSEMBL: ENSMUSP00000102415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106803] [ENSMUST00000106804]
Predicted Effect unknown
Transcript: ENSMUST00000106803
AA Change: D647E
SMART Domains Protein: ENSMUSP00000102415
Gene: ENSMUSG00000078612
AA Change: D647E

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 537 549 N/A INTRINSIC
low complexity region 567 578 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
SH3 735 791 3.82e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000106804
AA Change: D583E
SMART Domains Protein: ENSMUSP00000102416
Gene: ENSMUSG00000078612
AA Change: D583E

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 276 285 N/A INTRINSIC
low complexity region 378 395 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
SH3 671 727 3.82e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Fyb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Fyb2 APN 4 105015716 missense probably damaging 1.00
IGL01155:Fyb2 APN 4 104999386 missense probably benign 0.00
IGL01632:Fyb2 APN 4 104995811 missense probably benign
IGL01746:Fyb2 APN 4 104945207 missense probably benign 0.01
IGL02381:Fyb2 APN 4 104948666 splice site probably benign
IGL02590:Fyb2 APN 4 104979053 missense probably damaging 1.00
IGL02885:Fyb2 APN 4 105003921 missense probably damaging 0.99
IGL03114:Fyb2 APN 4 104995778 missense probably damaging 0.97
IGL03189:Fyb2 APN 4 105015742 missense probably damaging 1.00
IGL03231:Fyb2 APN 4 104986263 nonsense probably null
R0076:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R0662:Fyb2 UTSW 4 104995698 missense possibly damaging 0.46
R0723:Fyb2 UTSW 4 105015866 missense probably benign 0.00
R1216:Fyb2 UTSW 4 104995706 missense possibly damaging 0.86
R1672:Fyb2 UTSW 4 104950862 missense probably benign 0.10
R1710:Fyb2 UTSW 4 105003916 missense probably damaging 1.00
R1900:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R1965:Fyb2 UTSW 4 104913649 missense probably benign 0.00
R2106:Fyb2 UTSW 4 104945572 missense probably benign 0.01
R5191:Fyb2 UTSW 4 104995797 missense possibly damaging 0.88
R5236:Fyb2 UTSW 4 104948760 missense probably benign 0.00
R5277:Fyb2 UTSW 4 105015679 missense probably damaging 1.00
R5502:Fyb2 UTSW 4 104945324 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105013321 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105015644 missense probably damaging 1.00
R6167:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R6169:Fyb2 UTSW 4 105000516 missense probably benign 0.16
R6371:Fyb2 UTSW 4 104995778 missense probably damaging 0.97
R6582:Fyb2 UTSW 4 104945542 missense probably benign 0.00
R6713:Fyb2 UTSW 4 104990235 missense probably benign 0.16
R6719:Fyb2 UTSW 4 105010459 missense probably benign 0.07
R7484:Fyb2 UTSW 4 105013302 missense probably benign 0.01
R7534:Fyb2 UTSW 4 104999348 nonsense probably null
R7590:Fyb2 UTSW 4 104945246 missense probably benign 0.01
R7699:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R7700:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R8041:Fyb2 UTSW 4 105000484 missense possibly damaging 0.82
R8817:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R8873:Fyb2 UTSW 4 104999341 missense probably damaging 1.00
R8914:Fyb2 UTSW 4 105000503 missense probably benign 0.09
X0018:Fyb2 UTSW 4 104945210 missense probably benign 0.04
Z1176:Fyb2 UTSW 4 104913660 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACAGGTCAGATGCTCAGCG -3'
(R):5'- CCTTCAGATCACAGGGAATAGC -3'

Sequencing Primer
(F):5'- AGTTGTGTTTCTTCCCCAAGAGAGAC -3'
(R):5'- GAATAGCACCTCTGTCAGCATCTG -3'
Posted On2021-03-08