Incidental Mutation 'R8755:Ncapd2'
ID664099
Institutional Source Beutler Lab
Gene Symbol Ncapd2
Ensembl Gene ENSMUSG00000038252
Gene Namenon-SMC condensin I complex, subunit D2
Synonyms2810406C15Rik, 2810465G24Rik, CNAP1, CAP-D2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8755 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125168007-125191701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125171854 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 990 (C990S)
Ref Sequence ENSEMBL: ENSMUSP00000042260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043848]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043848
AA Change: C990S

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252
AA Change: C990S

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Ncapd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Ncapd2 APN 6 125173425 missense probably benign 0.05
IGL00960:Ncapd2 APN 6 125173848 missense probably benign
IGL01307:Ncapd2 APN 6 125168619 missense possibly damaging 0.56
IGL01612:Ncapd2 APN 6 125177872 missense probably benign 0.01
IGL01903:Ncapd2 APN 6 125177460 missense probably benign
IGL01987:Ncapd2 APN 6 125185841 splice site probably benign
IGL01998:Ncapd2 APN 6 125173115 missense probably benign 0.18
IGL01998:Ncapd2 APN 6 125169933 missense probably damaging 1.00
IGL02329:Ncapd2 APN 6 125189818 missense probably damaging 0.99
IGL02550:Ncapd2 APN 6 125177447 missense probably benign
IGL02662:Ncapd2 APN 6 125176731 missense probably damaging 1.00
IGL02817:Ncapd2 APN 6 125170914 critical splice donor site probably null
IGL03121:Ncapd2 APN 6 125173612 missense probably benign 0.00
IGL03206:Ncapd2 APN 6 125171697 missense possibly damaging 0.85
FR4548:Ncapd2 UTSW 6 125173596 critical splice donor site probably benign
PIT4305001:Ncapd2 UTSW 6 125184027 nonsense probably null
R0486:Ncapd2 UTSW 6 125184027 nonsense probably null
R0635:Ncapd2 UTSW 6 125173036 missense probably benign 0.00
R0699:Ncapd2 UTSW 6 125169880 missense probably benign
R0746:Ncapd2 UTSW 6 125174264 missense possibly damaging 0.50
R0893:Ncapd2 UTSW 6 125173482 missense probably benign
R1385:Ncapd2 UTSW 6 125173115 missense probably benign 0.18
R1513:Ncapd2 UTSW 6 125170992 missense probably damaging 1.00
R1601:Ncapd2 UTSW 6 125185772 missense probably damaging 1.00
R1698:Ncapd2 UTSW 6 125168590 missense probably null 0.39
R2030:Ncapd2 UTSW 6 125176715 missense possibly damaging 0.95
R2035:Ncapd2 UTSW 6 125184528 missense probably benign 0.17
R2359:Ncapd2 UTSW 6 125179416 unclassified probably benign
R3951:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3952:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3953:Ncapd2 UTSW 6 125170734 missense probably damaging 0.96
R4623:Ncapd2 UTSW 6 125173609 missense probably benign 0.04
R4630:Ncapd2 UTSW 6 125179233 splice site probably null
R4667:Ncapd2 UTSW 6 125184518 missense possibly damaging 0.69
R4769:Ncapd2 UTSW 6 125185745 missense probably damaging 1.00
R4936:Ncapd2 UTSW 6 125169840 missense probably benign 0.18
R5130:Ncapd2 UTSW 6 125169924 missense possibly damaging 0.90
R5465:Ncapd2 UTSW 6 125176783 missense probably damaging 0.98
R5806:Ncapd2 UTSW 6 125181154 missense probably damaging 0.98
R5823:Ncapd2 UTSW 6 125168700 missense probably benign 0.00
R5888:Ncapd2 UTSW 6 125187089 missense probably damaging 1.00
R5940:Ncapd2 UTSW 6 125168869 missense probably benign
R6198:Ncapd2 UTSW 6 125179323 nonsense probably null
R6406:Ncapd2 UTSW 6 125173878 missense probably benign
R6652:Ncapd2 UTSW 6 125186270 missense probably benign 0.13
R6959:Ncapd2 UTSW 6 125168920 missense probably benign
R6977:Ncapd2 UTSW 6 125171509 missense probably damaging 1.00
R6982:Ncapd2 UTSW 6 125176736 missense probably damaging 0.96
R7143:Ncapd2 UTSW 6 125179561 missense probably benign
R7144:Ncapd2 UTSW 6 125176670 missense probably benign 0.11
R7186:Ncapd2 UTSW 6 125186156 missense possibly damaging 0.89
R7203:Ncapd2 UTSW 6 125184328 missense possibly damaging 0.58
R7384:Ncapd2 UTSW 6 125173401 missense probably benign
R8039:Ncapd2 UTSW 6 125181026 missense probably damaging 0.98
R8047:Ncapd2 UTSW 6 125189799 missense probably damaging 0.98
R8048:Ncapd2 UTSW 6 125179698 nonsense probably null
R8056:Ncapd2 UTSW 6 125171043 missense probably damaging 1.00
R8097:Ncapd2 UTSW 6 125168982 missense possibly damaging 0.78
R8489:Ncapd2 UTSW 6 125173782 missense probably damaging 0.98
R8496:Ncapd2 UTSW 6 125170164 missense probably damaging 0.99
R8776:Ncapd2 UTSW 6 125177513 missense probably benign
R8776-TAIL:Ncapd2 UTSW 6 125177513 missense probably benign
RF045:Ncapd2 UTSW 6 125179236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGAGCTCTGGGTTGCTGTATAAG -3'
(R):5'- TCTTAAAGCAGGGTGAAGCG -3'

Sequencing Primer
(F):5'- CTGTATAAGCCAGGGTTGTTACAGAC -3'
(R):5'- GGTGCACGCCTTTAATGC -3'
Posted On2021-03-08