Incidental Mutation 'R8755:Tnfrsf1a'
ID 664100
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1a
Ensembl Gene ENSMUSG00000030341
Gene Name tumor necrosis factor receptor superfamily, member 1a
Synonyms CD120a, TNFalpha-R1, TNF-R1, p55-R, TNF receptor alpha chain, TNF-R55, TNFRI, TNFRp55, TNFAR, TNFR60, TNF-R-I, Tnfr1, p55, TNF-alpha-R1, TNF-alphaR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 125349362-125362484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125357805 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 14 (L14Q)
Ref Sequence ENSEMBL: ENSMUSP00000117470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000042647] [ENSMUST00000130257] [ENSMUST00000144524]
AlphaFold P25118
Predicted Effect probably benign
Transcript: ENSMUST00000032491
AA Change: L136Q

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341
AA Change: L136Q

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042647
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341
AA Change: L52Q

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130257
SMART Domains Protein: ENSMUSP00000115991
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TNFR_c6 44 66 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134803
Predicted Effect probably benign
Transcript: ENSMUST00000144524
AA Change: L14Q

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341
AA Change: L14Q

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mice lacking a functional copy of this gene exhibit impaired immune function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted splenic architecture, increased adult liver weights, reduced IgG immune response, deficits in some host defense and inflammatory responses, LPS resistance, and reduced graft-vs-host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Tnfrsf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Tnfrsf1a APN 6 125356864 missense probably damaging 1.00
IGL02468:Tnfrsf1a APN 6 125357861 missense probably benign 0.06
IGL02588:Tnfrsf1a APN 6 125360766 missense probably benign 0.44
R1302:Tnfrsf1a UTSW 6 125356916 missense probably damaging 1.00
R2189:Tnfrsf1a UTSW 6 125357805 missense probably benign 0.42
R4559:Tnfrsf1a UTSW 6 125360766 missense probably benign 0.44
R4794:Tnfrsf1a UTSW 6 125358084 missense probably damaging 1.00
R5039:Tnfrsf1a UTSW 6 125360712 missense possibly damaging 0.67
R5364:Tnfrsf1a UTSW 6 125357393 missense possibly damaging 0.87
R5792:Tnfrsf1a UTSW 6 125358077 missense probably damaging 1.00
R6742:Tnfrsf1a UTSW 6 125356948 missense probably damaging 0.99
R7018:Tnfrsf1a UTSW 6 125356951 missense probably damaging 1.00
R7128:Tnfrsf1a UTSW 6 125361536 missense probably benign 0.11
R7192:Tnfrsf1a UTSW 6 125361596 missense unknown
R7715:Tnfrsf1a UTSW 6 125361414 missense possibly damaging 0.65
R8745:Tnfrsf1a UTSW 6 125361782 missense probably damaging 0.99
R8856:Tnfrsf1a UTSW 6 125357725 missense possibly damaging 0.85
R9005:Tnfrsf1a UTSW 6 125356915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGACGAATGCCATGTG -3'
(R):5'- GTTAAGACTAAGAGCGCGTGC -3'

Sequencing Primer
(F):5'- AATGTCCCAGGTGGAGAT -3'
(R):5'- TGCCTGCAGTCTGAGGG -3'
Posted On 2021-03-08