Incidental Mutation 'R8755:Ryr1'
ID 664104
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms skrr, calcium release channel isoform 1, Ryr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 29003344-29125179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29092268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1404 (V1404I)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032813
AA Change: V1397I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: V1397I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179893
AA Change: V1397I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: V1397I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214374
AA Change: V1404I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29098785 missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29067630 missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29104832 missense probably benign 0.39
R7799:Ryr1 UTSW 7 29003560 splice site probably null
R7916:Ryr1 UTSW 7 29090939 nonsense probably null
R7922:Ryr1 UTSW 7 29097224 missense probably benign 0.09
R7988:Ryr1 UTSW 7 29096171 missense probably benign 0.29
R7997:Ryr1 UTSW 7 29003543 missense unknown
R8052:Ryr1 UTSW 7 29083385 missense probably benign 0.05
R8096:Ryr1 UTSW 7 29009201 missense unknown
R8116:Ryr1 UTSW 7 29110883 missense probably benign 0.03
R8202:Ryr1 UTSW 7 29091032 missense probably benign 0.18
R8207:Ryr1 UTSW 7 29090225 missense probably damaging 1.00
R8248:Ryr1 UTSW 7 29069121 missense probably damaging 1.00
R8257:Ryr1 UTSW 7 29064639 missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 29015717 missense unknown
R8454:Ryr1 UTSW 7 29015717 missense unknown
R8487:Ryr1 UTSW 7 29040867 missense probably damaging 0.97
R8529:Ryr1 UTSW 7 29070084 missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 29004814 unclassified probably benign
R8678:Ryr1 UTSW 7 29077064 missense probably damaging 0.99
R8717:Ryr1 UTSW 7 29052328 missense probably benign 0.03
R8724:Ryr1 UTSW 7 29117377 missense probably benign 0.04
R8772:Ryr1 UTSW 7 29116132 missense probably benign 0.05
R8790:Ryr1 UTSW 7 29076872 missense probably damaging 1.00
R8793:Ryr1 UTSW 7 29064859 missense probably damaging 1.00
R8836:Ryr1 UTSW 7 29074666 missense probably damaging 1.00
R8858:Ryr1 UTSW 7 29109213 missense probably benign 0.00
R8910:Ryr1 UTSW 7 29071915 missense probably damaging 1.00
R8920:Ryr1 UTSW 7 29090215 missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 29101933 missense probably damaging 1.00
R9035:Ryr1 UTSW 7 29090997 missense probably damaging 0.97
R9115:Ryr1 UTSW 7 29104564 nonsense probably null
R9123:Ryr1 UTSW 7 29071804 missense probably damaging 1.00
R9154:Ryr1 UTSW 7 29069858 missense probably benign 0.08
R9189:Ryr1 UTSW 7 29077046 missense probably damaging 1.00
R9200:Ryr1 UTSW 7 29095099 missense probably benign 0.00
R9214:Ryr1 UTSW 7 29085762 missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 29101852 missense probably damaging 0.97
R9240:Ryr1 UTSW 7 29043888 missense probably damaging 1.00
R9261:Ryr1 UTSW 7 29052388 missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 29102829 missense probably damaging 0.99
R9280:Ryr1 UTSW 7 29102964 missense probably damaging 1.00
R9316:Ryr1 UTSW 7 29017962 missense unknown
R9333:Ryr1 UTSW 7 29074789 critical splice donor site probably null
R9459:Ryr1 UTSW 7 29068643 missense probably damaging 1.00
R9468:Ryr1 UTSW 7 29073085 missense probably damaging 1.00
R9486:Ryr1 UTSW 7 29078540 missense probably benign 0.15
R9524:Ryr1 UTSW 7 29024175 missense probably damaging 1.00
R9620:Ryr1 UTSW 7 29015713 missense unknown
R9664:Ryr1 UTSW 7 29059667 missense probably damaging 1.00
R9776:Ryr1 UTSW 7 29075239 missense probably damaging 1.00
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29020214 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29086035 missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29103498 missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29017985 missense unknown
Z1177:Ryr1 UTSW 7 29048792 nonsense probably null
Z1177:Ryr1 UTSW 7 29101922 missense probably damaging 1.00
Z1186:Ryr1 UTSW 7 29082477 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTAGAATGTATTGGGGTATCTCAGC -3'
(R):5'- AGTCAGGAATCCCCGTTCTC -3'

Sequencing Primer
(F):5'- GGTATCTCAGCTATAAGGATGACAAC -3'
(R):5'- GAATCCCCGTTCTCCAGCG -3'
Posted On 2021-03-08