Incidental Mutation 'R8755:Dcaf11'
ID664131
Institutional Source Beutler Lab
Gene Symbol Dcaf11
Ensembl Gene ENSMUSG00000022214
Gene NameDDB1 and CUL4 associated factor 11
Synonyms0710008A13Rik, GLO14, D14Ucla1, Wdr23
MMRRC Submission
Accession Numbers

Genbank: NM_133734; MGI: 90168

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8755 (G1)
Quality Score181.009
Status Not validated
Chromosome14
Chromosomal Location55560006-55570065 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 55560566 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066106] [ENSMUST00000072530] [ENSMUST00000117236] [ENSMUST00000117701] [ENSMUST00000121622] [ENSMUST00000128490] [ENSMUST00000133256] [ENSMUST00000143375] [ENSMUST00000143431] [ENSMUST00000147981] [ENSMUST00000150019] [ENSMUST00000150481] [ENSMUST00000152681]
Predicted Effect probably benign
Transcript: ENSMUST00000066106
Predicted Effect probably benign
Transcript: ENSMUST00000072530
SMART Domains Protein: ENSMUSP00000072344
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117236
SMART Domains Protein: ENSMUSP00000113014
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117701
SMART Domains Protein: ENSMUSP00000113620
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WD40 122 160 8.91e-1 SMART
WD40 165 206 8.25e0 SMART
WD40 212 253 2.39e0 SMART
WD40 256 296 1.44e-5 SMART
WD40 304 343 1.26e-5 SMART
WD40 384 429 1.72e0 SMART
WD40 432 471 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121622
SMART Domains Protein: ENSMUSP00000113202
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128490
SMART Domains Protein: ENSMUSP00000114211
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133256
SMART Domains Protein: ENSMUSP00000118404
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143375
SMART Domains Protein: ENSMUSP00000121570
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143431
SMART Domains Protein: ENSMUSP00000118762
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147981
SMART Domains Protein: ENSMUSP00000123453
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150019
SMART Domains Protein: ENSMUSP00000117617
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150481
SMART Domains Protein: ENSMUSP00000119001
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152681
SMART Domains Protein: ENSMUSP00000120296
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Dcaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Dcaf11 APN 14 55561285 utr 5 prime probably benign
IGL02158:Dcaf11 APN 14 55564523 splice site probably null
IGL02487:Dcaf11 APN 14 55569114 missense probably benign 0.06
IGL02887:Dcaf11 APN 14 55564135 missense probably damaging 1.00
IGL03263:Dcaf11 APN 14 55565492 missense probably damaging 0.99
IGL03392:Dcaf11 APN 14 55561421 missense probably damaging 1.00
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0084:Dcaf11 UTSW 14 55569243 missense probably benign 0.00
R0110:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0450:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0510:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0662:Dcaf11 UTSW 14 55565507 missense possibly damaging 0.93
R1087:Dcaf11 UTSW 14 55569124 missense probably damaging 0.96
R2281:Dcaf11 UTSW 14 55569371 makesense probably null
R2698:Dcaf11 UTSW 14 55566885 missense probably damaging 1.00
R2866:Dcaf11 UTSW 14 55565745 missense possibly damaging 0.92
R4472:Dcaf11 UTSW 14 55565606 intron probably benign
R5288:Dcaf11 UTSW 14 55563376 missense probably damaging 1.00
R5682:Dcaf11 UTSW 14 55563426 missense probably damaging 1.00
R5706:Dcaf11 UTSW 14 55565695 missense probably damaging 1.00
R7133:Dcaf11 UTSW 14 55568926 splice site probably null
R7468:Dcaf11 UTSW 14 55565509 missense possibly damaging 0.70
R7673:Dcaf11 UTSW 14 55569305 missense probably benign 0.00
R8861:Dcaf11 UTSW 14 55564498 nonsense probably null
R8959:Dcaf11 UTSW 14 55569304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCTACGTCTAATGCAGGTC -3'
(R):5'- CAGTTTAGCTTCACGCCCAC -3'

Sequencing Primer
(F):5'- AGGTCGCAGCCAATTCCAGTC -3'
(R):5'- AAATGGAGAAGCACCTCC -3'
Posted On2021-03-08