Incidental Mutation 'R8755:Pkdrej'
ID664133
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8755 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85819606 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 710 (T710A)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably benign
Transcript: ENSMUST00000064370
AA Change: T710A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: T710A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Lgals12 C T 19: 7,603,980 E121K possibly damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 splice site probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R8121:Pkdrej UTSW 15 85815454 missense probably benign 0.00
R8140:Pkdrej UTSW 15 85818410 missense probably damaging 1.00
R8219:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
R8222:Pkdrej UTSW 15 85817439 missense probably benign
R8432:Pkdrej UTSW 15 85817293 missense probably benign 0.00
R8786:Pkdrej UTSW 15 85819843 missense probably benign 0.01
R8817:Pkdrej UTSW 15 85818573 missense probably damaging 1.00
R8827:Pkdrej UTSW 15 85815531 missense possibly damaging 0.76
Z1177:Pkdrej UTSW 15 85816537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAGTTTGGACAGAGTGAATC -3'
(R):5'- TGCTATGAACACAGCGGATG -3'

Sequencing Primer
(F):5'- CAGAGTGAATCATTTCTGAAGGCC -3'
(R):5'- CGGATGAGATCGGTCAGTC -3'
Posted On2021-03-08