Incidental Mutation 'R8755:Lgals12'
ID664142
Institutional Source Beutler Lab
Gene Symbol Lgals12
Ensembl Gene ENSMUSG00000024972
Gene Namelectin, galactose binding, soluble 12
SynonymsGRIP1, galectin-12, galectin-related inhibitor of proliferation
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8755 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location7596660-7607193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7603980 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 121 (E121K)
Ref Sequence ENSEMBL: ENSMUSP00000097318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079902] [ENSMUST00000099729] [ENSMUST00000159983]
Predicted Effect probably damaging
Transcript: ENSMUST00000079902
AA Change: E121K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078824
Gene: ENSMUSG00000024972
AA Change: E121K

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 181 301 3.6e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099729
AA Change: E121K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097318
Gene: ENSMUSG00000024972
AA Change: E121K

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159983
AA Change: E121K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124610
Gene: ENSMUSG00000024972
AA Change: E121K

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lipolysis, reduced adiposity, and enhanced insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,490 I1868V probably benign Het
Aaas A C 15: 102,347,085 D86E probably benign Het
Akap3 A G 6: 126,866,167 D583G possibly damaging Het
Alms1 T A 6: 85,621,574 D1127E probably benign Het
Anks4b T A 7: 120,174,084 probably null Het
Ano8 A T 8: 71,483,080 F298Y probably benign Het
Arhgef2 C A 3: 88,629,543 Q7K probably benign Het
BC055324 A G 1: 163,959,326 S725P probably damaging Het
Cand2 T C 6: 115,792,980 L917P probably damaging Het
Car8 T C 4: 8,238,083 D44G probably benign Het
Cdk1 T C 10: 69,340,605 N224S probably benign Het
Cep162 T C 9: 87,232,011 E336G probably benign Het
Chd7 T C 4: 8,866,069 M2792T probably benign Het
Cyp4f40 A T 17: 32,667,983 K143* probably null Het
Cyth1 T A 11: 118,183,942 M178L probably benign Het
Dcaf11 C T 14: 55,560,566 probably benign Het
Dlec1 T G 9: 119,138,157 W1203G probably damaging Het
Fgd4 A T 16: 16,484,269 S141T probably benign Het
Flg2 T A 3: 93,200,813 D49E probably damaging Het
Fyb2 T A 4: 105,003,889 D647E unknown Het
Gstp1 T C 19: 4,036,698 Y109C probably damaging Het
Gtf3c3 T C 1: 54,428,872 E202G probably benign Het
Hephl1 A G 9: 15,074,267 F698L probably benign Het
Hephl1 G T 9: 15,111,984 P41T probably damaging Het
Hmcn1 T A 1: 150,633,620 E3659V probably benign Het
Il27ra A T 8: 84,039,359 D229E probably damaging Het
Itih2 T A 2: 10,098,558 D706V probably damaging Het
Itpr2 A T 6: 146,232,428 C1893S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Laptm4b A G 15: 34,273,274 D111G probably damaging Het
Ldb3 T A 14: 34,577,299 S123C probably damaging Het
Mmp13 T A 9: 7,277,996 S296R possibly damaging Het
Mpeg1 T C 19: 12,461,874 F232S probably damaging Het
Ncapd2 A T 6: 125,171,854 C990S possibly damaging Het
Nckap5 A T 1: 126,026,542 C758S possibly damaging Het
Nwd1 A T 8: 72,667,564 D485V probably damaging Het
Olfr150 T A 9: 39,737,490 I225N probably damaging Het
Olfr532 T G 7: 140,419,504 S90R probably benign Het
Olfr791 T C 10: 129,526,463 F79L possibly damaging Het
Pcgf3 G A 5: 108,486,242 R122Q probably benign Het
Pgm5 T A 19: 24,834,848 I107F probably damaging Het
Pid1 G T 1: 84,038,345 H114N probably damaging Het
Pkdrej T C 15: 85,819,606 T710A probably benign Het
Plpbp T A 8: 27,045,137 probably null Het
Ppfibp2 T G 7: 107,744,225 F824V probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Psg17 T A 7: 18,816,911 T340S possibly damaging Het
Pstpip2 T C 18: 77,873,433 S239P probably damaging Het
Ralbp1 A C 17: 65,859,041 S383A possibly damaging Het
Ranbp2 T A 10: 58,465,147 L613* probably null Het
Rgs11 T C 17: 26,203,372 V49A probably damaging Het
Ryr1 C T 7: 29,092,268 V1404I probably benign Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Slc22a13 T A 9: 119,209,060 M1L probably damaging Het
Slc5a1 A T 5: 33,159,182 I591L probably benign Het
Tacr2 T A 10: 62,252,954 V46E possibly damaging Het
Tet2 C T 3: 133,488,278 G132S probably damaging Het
Thsd7a G A 6: 12,408,852 R724* probably null Het
Tmco3 A T 8: 13,291,782 I19L probably benign Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tpm1 A T 9: 67,028,089 L248Q probably benign Het
Tprn T A 2: 25,264,015 I443N probably benign Het
Unc80 A T 1: 66,612,131 H1545L possibly damaging Het
Vmn2r97 T A 17: 18,947,842 M786K probably damaging Het
Wipi1 C T 11: 109,603,819 V63M probably damaging Het
Zcchc4 G A 5: 52,819,382 R506H unknown Het
Zfand6 A T 7: 84,632,691 V110E probably benign Het
Zfp866 A T 8: 69,766,731 Y80N possibly damaging Het
Other mutations in Lgals12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Lgals12 APN 19 7606654 splice site probably benign
IGL02630:Lgals12 APN 19 7601242 splice site probably benign
IGL02700:Lgals12 APN 19 7598090 missense probably benign 0.01
R0129:Lgals12 UTSW 19 7603038 missense probably damaging 0.99
R1398:Lgals12 UTSW 19 7603957 splice site probably benign
R1421:Lgals12 UTSW 19 7606714 missense probably benign 0.08
R1548:Lgals12 UTSW 19 7604312 missense probably benign 0.12
R1697:Lgals12 UTSW 19 7604165 missense possibly damaging 0.91
R2075:Lgals12 UTSW 19 7598845 missense possibly damaging 0.81
R2192:Lgals12 UTSW 19 7601241 splice site probably null
R2253:Lgals12 UTSW 19 7606765 start gained probably benign
R4256:Lgals12 UTSW 19 7606716 missense possibly damaging 0.93
R4738:Lgals12 UTSW 19 7604099 missense probably benign 0.01
R5495:Lgals12 UTSW 19 7604130 missense probably damaging 1.00
R5810:Lgals12 UTSW 19 7606720 missense probably benign 0.00
R6139:Lgals12 UTSW 19 7604377 missense probably benign 0.07
R7414:Lgals12 UTSW 19 7603970 missense probably damaging 1.00
X0067:Lgals12 UTSW 19 7603964 splice site probably null
Z1177:Lgals12 UTSW 19 7598080 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGCATGGGTCTTCTGAGTG -3'
(R):5'- ATCCTCAGCCAGATGTTGCC -3'

Sequencing Primer
(F):5'- CTACTAGATCCAGGGACTTTTGCAG -3'
(R):5'- AGCCAGATGTTGCCTTCCG -3'
Posted On2021-03-08