Incidental Mutation 'R8756:Gtf2ird2'
ID664164
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R8756 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134197249 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 179 (P179S)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000123941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016086
AA Change: P179S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: P179S

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A T 6: 87,188,253 S401T probably damaging Het
Armh1 T A 4: 117,237,664 I60L probably benign Het
Atp8b5 T C 4: 43,342,439 V370A probably damaging Het
Atraid T A 5: 31,054,041 Y184N probably damaging Het
Cp G C 3: 20,005,572 probably null Het
Crebbp A G 16: 4,085,903 I1824T probably benign Het
Cyp2c65 A T 19: 39,061,108 R27* probably null Het
Dtl T C 1: 191,539,259 H725R probably benign Het
Dync1h1 G T 12: 110,616,827 A453S probably benign Het
Fat3 T A 9: 16,376,589 D546V probably damaging Het
Flt1 T C 5: 147,639,414 T595A probably benign Het
Hoga1 A G 19: 42,060,277 I145V probably benign Het
Igfn1 G T 1: 135,967,960 Q1623K probably benign Het
Jsrp1 T A 10: 80,812,106 probably null Het
Krt90 A C 15: 101,562,344 probably null Het
Lrch3 T A 16: 32,988,440 S514T probably benign Het
Mad2l1 T C 6: 66,535,585 V20A probably damaging Het
Malrd1 T C 2: 15,752,895 probably null Het
Matn2 A C 15: 34,423,730 E578A possibly damaging Het
Myof A T 19: 37,939,952 W1050R probably benign Het
Nemp1 T A 10: 127,692,976 I183N probably benign Het
Nid1 A G 13: 13,508,801 T1155A probably benign Het
Nsd1 T C 13: 55,313,693 S2681P probably benign Het
Olfr1191-ps1 T A 2: 88,642,839 V24E possibly damaging Het
Olfr715 T C 7: 107,128,812 T194A probably benign Het
Onecut3 C A 10: 80,513,916 R415S probably damaging Het
Pclo T A 5: 14,714,384 S1005R Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
R3hcc1l G A 19: 42,563,634 V357M probably damaging Het
Sec63 C T 10: 42,810,909 T475M possibly damaging Het
Serpinh1 A G 7: 99,347,152 Y242H probably damaging Het
Slit2 G T 5: 48,302,487 E1370* probably null Het
Sos2 C A 12: 69,648,536 L142F probably damaging Het
Spag4 T C 2: 156,066,573 L141P possibly damaging Het
Sun1 T C 5: 139,236,689 L570P probably damaging Het
Tars2 A G 3: 95,741,360 V662A probably benign Het
Tmem245 C A 4: 56,899,025 probably null Het
Tpp2 T A 1: 43,960,135 Y356* probably null Het
Trafd1 T C 5: 121,375,815 E303G probably damaging Het
Trim71 T C 9: 114,513,537 E559G possibly damaging Het
Ush2a T A 1: 188,911,944 V4501E possibly damaging Het
Vegfa T C 17: 46,031,539 T118A probably damaging Het
Vmn2r124 A T 17: 18,073,832 H727L probably benign Het
Zdhhc2 T A 8: 40,467,510 V270E probably damaging Het
Zfp112 T C 7: 24,125,572 S326P probably benign Het
Zfp37 T C 4: 62,192,134 D272G possibly damaging Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 splice site probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0568:Gtf2ird2 UTSW 5 134211242 nonsense probably null
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R2375:Gtf2ird2 UTSW 5 134217135 missense probably benign 0.20
R3104:Gtf2ird2 UTSW 5 134208915 missense probably benign 0.42
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5261:Gtf2ird2 UTSW 5 134216219 missense probably benign 0.00
R5379:Gtf2ird2 UTSW 5 134217468 missense probably benign
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
R7355:Gtf2ird2 UTSW 5 134216649 missense probably benign 0.24
R7475:Gtf2ird2 UTSW 5 134201426 missense possibly damaging 0.47
R7566:Gtf2ird2 UTSW 5 134214006 missense probably damaging 1.00
R8021:Gtf2ird2 UTSW 5 134203334 missense probably benign
R8701:Gtf2ird2 UTSW 5 134216235 missense probably damaging 1.00
R8898:Gtf2ird2 UTSW 5 134197265 missense probably benign
R8946:Gtf2ird2 UTSW 5 134216319 missense probably damaging 1.00
R8955:Gtf2ird2 UTSW 5 134216754 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGTTGTGAGCCACCATG -3'
(R):5'- ACTCTAGGCAGCTGCTGAACT -3'

Sequencing Primer
(F):5'- GCTGGGAATTGAACTCAGAACTTC -3'
(R):5'- GGTAAGAGATCTACTATCAAGCTGCC -3'
Posted On2021-03-08